Incidental Mutation 'R2443:Edem1'
ID249866
Institutional Source Beutler Lab
Gene Symbol Edem1
Ensembl Gene ENSMUSG00000030104
Gene NameER degradation enhancer, mannosidase alpha-like 1
SynonymsA130059K23Rik
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location108828641-108859356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108851269 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 518 (K518N)
Ref Sequence ENSEMBL: ENSMUSP00000144901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089162] [ENSMUST00000204804]
Predicted Effect probably benign
Transcript: ENSMUST00000089162
AA Change: K518N

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086565
Gene: ENSMUSG00000030104
AA Change: K518N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 581 1.1e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204524
Predicted Effect probably benign
Transcript: ENSMUST00000204804
AA Change: K518N

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144901
Gene: ENSMUSG00000030104
AA Change: K518N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 529 9.9e-97 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Edem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Edem1 APN 6 108855559 utr 3 prime probably benign
IGL00648:Edem1 APN 6 108851207 splice site probably null
IGL00694:Edem1 APN 6 108841601 missense possibly damaging 0.95
IGL02231:Edem1 APN 6 108828888 missense probably benign 0.06
IGL02967:Edem1 APN 6 108836777 missense probably damaging 1.00
IGL03018:Edem1 APN 6 108829142 missense probably damaging 0.98
PIT4468001:Edem1 UTSW 6 108844867 missense probably damaging 0.98
R0050:Edem1 UTSW 6 108828848 missense possibly damaging 0.91
R0367:Edem1 UTSW 6 108846752 missense probably damaging 1.00
R1165:Edem1 UTSW 6 108851253 missense probably damaging 1.00
R1354:Edem1 UTSW 6 108854316 missense possibly damaging 0.93
R1385:Edem1 UTSW 6 108846684 missense probably damaging 1.00
R1588:Edem1 UTSW 6 108841679 missense probably damaging 1.00
R1964:Edem1 UTSW 6 108844947 missense probably benign 0.03
R2060:Edem1 UTSW 6 108854287 missense probably damaging 0.99
R2106:Edem1 UTSW 6 108848725 missense probably damaging 0.98
R2393:Edem1 UTSW 6 108852543 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3733:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3734:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R4754:Edem1 UTSW 6 108841697 missense probably damaging 1.00
R4791:Edem1 UTSW 6 108841634 missense probably damaging 1.00
R4792:Edem1 UTSW 6 108828746 unclassified probably benign
R5326:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5334:Edem1 UTSW 6 108848832 critical splice donor site probably null
R5501:Edem1 UTSW 6 108843100 critical splice donor site probably null
R5542:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5976:Edem1 UTSW 6 108842962 missense probably damaging 0.99
R6177:Edem1 UTSW 6 108851198 splice site probably null
R6556:Edem1 UTSW 6 108854357 missense probably benign 0.00
R6835:Edem1 UTSW 6 108854399 missense probably benign 0.00
R7192:Edem1 UTSW 6 108829004 missense probably benign 0.00
R7239:Edem1 UTSW 6 108854380 missense probably benign
R7442:Edem1 UTSW 6 108851305 nonsense probably null
R7780:Edem1 UTSW 6 108841628 missense probably benign 0.00
R7902:Edem1 UTSW 6 108854377 missense possibly damaging 0.88
R8103:Edem1 UTSW 6 108852563 missense probably damaging 1.00
R8135:Edem1 UTSW 6 108829061 nonsense probably null
R8359:Edem1 UTSW 6 108846813 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGTTAGCTAGGGATCCAGC -3'
(R):5'- AGACACATCCTCCCAGATAAATT -3'

Sequencing Primer
(F):5'- GGGATCCAGCCCCTTAGG -3'
(R):5'- GCATCTATAATCCAGTCTCAGGGG -3'
Posted On2014-11-12