Incidental Mutation 'R2443:Clec4d'
ID249867
Institutional Source Beutler Lab
Gene Symbol Clec4d
Ensembl Gene ENSMUSG00000030144
Gene NameC-type lectin domain family 4, member d
SynonymsClecsf8, mcl, Mpcl, mMCL
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123262111-123275265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123268117 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 119 (V119M)
Ref Sequence ENSEMBL: ENSMUSP00000032240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032240] [ENSMUST00000204826]
Predicted Effect probably benign
Transcript: ENSMUST00000032240
AA Change: V119M

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032240
Gene: ENSMUSG00000030144
AA Change: V119M

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 83 207 1.59e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203421
Predicted Effect probably benign
Transcript: ENSMUST00000204826
SMART Domains Protein: ENSMUSP00000145134
Gene: ENSMUSG00000030144

DomainStartEndE-ValueType
Blast:CLECT 28 77 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to trehalose-6,60'-dimycolate treatment. Mice homozygous for a different knock-out allele exhibit increased susceptibility to pneumonia infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Clec4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Clec4d APN 6 123274773 missense probably damaging 1.00
R0111:Clec4d UTSW 6 123268047 nonsense probably null
R0157:Clec4d UTSW 6 123267136 missense probably benign 0.00
R1756:Clec4d UTSW 6 123267109 missense probably damaging 0.99
R1928:Clec4d UTSW 6 123267161 splice site probably null
R1964:Clec4d UTSW 6 123262360 missense probably benign 0.05
R2208:Clec4d UTSW 6 123265355 missense probably damaging 0.98
R4740:Clec4d UTSW 6 123268113 missense probably damaging 1.00
R5101:Clec4d UTSW 6 123267112 missense probably damaging 1.00
R5692:Clec4d UTSW 6 123268145 critical splice donor site probably null
R5785:Clec4d UTSW 6 123274770 missense probably benign 0.09
R5903:Clec4d UTSW 6 123267061 missense probably damaging 0.98
R6005:Clec4d UTSW 6 123267159 missense probably damaging 0.99
R6209:Clec4d UTSW 6 123270529 intron probably null
R7760:Clec4d UTSW 6 123270341 missense probably benign 0.01
R7867:Clec4d UTSW 6 123267164 critical splice donor site probably null
R7950:Clec4d UTSW 6 123267164 critical splice donor site probably null
Z1176:Clec4d UTSW 6 123274686 missense probably benign 0.01
Z1177:Clec4d UTSW 6 123268074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAATTAAGTGCTCCTTGGTAAC -3'
(R):5'- CTTCTCTGTGAAGGGAATTAAAGC -3'

Sequencing Primer
(F):5'- AGTGCTCCTTGGTAACTAACATC -3'
(R):5'- TAACTGGTGGTCTTGACACAGCC -3'
Posted On2014-11-12