Incidental Mutation 'R2443:Zfp61'
ID249868
Institutional Source Beutler Lab
Gene Symbol Zfp61
Ensembl Gene ENSMUSG00000050605
Gene Namezinc finger protein 61
Synonyms
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24291039-24301232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24291769 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000132551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077780] [ENSMUST00000145131] [ENSMUST00000165241]
Predicted Effect probably benign
Transcript: ENSMUST00000077780
AA Change: V319A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076954
Gene: ENSMUSG00000050605
AA Change: V319A

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139811
Predicted Effect probably benign
Transcript: ENSMUST00000145131
SMART Domains Protein: ENSMUSP00000117077
Gene: ENSMUSG00000050605

DomainStartEndE-ValueType
KRAB 4 64 4.63e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165241
AA Change: V319A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000132551
Gene: ENSMUSG00000050605
AA Change: V319A

DomainStartEndE-ValueType
KRAB 4 63 2.28e-27 SMART
ZnF_C2H2 311 333 1.4e-4 SMART
ZnF_C2H2 339 361 5.5e-3 SMART
ZnF_C2H2 367 389 2.99e-4 SMART
ZnF_C2H2 395 417 1.18e-2 SMART
ZnF_C2H2 423 445 2.4e-3 SMART
ZnF_C2H2 451 473 2.95e-3 SMART
ZnF_C2H2 479 501 9.88e-5 SMART
ZnF_C2H2 507 529 1.5e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Zfp61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Zfp61 APN 7 24291095 missense probably benign 0.00
R0771:Zfp61 UTSW 7 24293354 missense probably benign 0.00
R1574:Zfp61 UTSW 7 24291210 missense probably damaging 0.98
R1574:Zfp61 UTSW 7 24291210 missense probably damaging 0.98
R2029:Zfp61 UTSW 7 24292289 missense probably benign 0.00
R3771:Zfp61 UTSW 7 24295981 start codon destroyed probably null 0.01
R3773:Zfp61 UTSW 7 24295981 start codon destroyed probably null 0.01
R4093:Zfp61 UTSW 7 24291275 splice site probably null
R4095:Zfp61 UTSW 7 24291275 splice site probably null
R7533:Zfp61 UTSW 7 24291079 missense probably benign 0.01
R8423:Zfp61 UTSW 7 24292034 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CGACTGAATTCTTTCCCGCAG -3'
(R):5'- TCACCAAGTGTTAGACTCAGGAG -3'

Sequencing Primer
(F):5'- AGTCCACGCATTTATAGGGC -3'
(R):5'- CTCAGGAGGGAGGGCTTG -3'
Posted On2014-11-12