Incidental Mutation 'R2443:Anapc13'
ID249877
Institutional Source Beutler Lab
Gene Symbol Anapc13
Ensembl Gene ENSMUSG00000035048
Gene Nameanaphase promoting complex subunit 13
Synonyms1810004D07Rik
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location102626296-102634425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102634023 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 37 (P37S)
Ref Sequence ENSEMBL: ENSMUSP00000140967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038673] [ENSMUST00000186693] [ENSMUST00000188398] [ENSMUST00000190279]
Predicted Effect probably damaging
Transcript: ENSMUST00000038673
AA Change: P37S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039761
Gene: ENSMUSG00000035048
AA Change: P37S

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186693
AA Change: P37S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139762
Gene: ENSMUSG00000035048
AA Change: P37S

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188398
AA Change: P37S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140325
Gene: ENSMUSG00000035048
AA Change: P37S

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190279
AA Change: P37S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140967
Gene: ENSMUSG00000035048
AA Change: P37S

DomainStartEndE-ValueType
Pfam:Apc13p 1 74 6.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190354
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the anaphase promoting complex, a large ubiquitin-protein ligase that controls cell cycle progression by regulating the degradation of cell cycle regulators such as B-type cyclins. The encoded protein is evolutionarily conserved and is required for the integrity and ubiquitin ligase activity of the anaphase promoting complex. Pseudogenes and splice variants have been found for this gene; however, the biological validity of some of the splice variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Anapc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4785:Anapc13 UTSW 9 102629821 missense probably benign 0.05
R6534:Anapc13 UTSW 9 102634093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTAACTGCAGGACCAGGTC -3'
(R):5'- GCATTTGGCGACAGGAAAC -3'

Sequencing Primer
(F):5'- CAGCTCCTGGGAGGCAAAG -3'
(R):5'- GGCGACAGGAAACATTTTTATCCC -3'
Posted On2014-11-12