Incidental Mutation 'R2443:Mmp19'
ID249878
Institutional Source Beutler Lab
Gene Symbol Mmp19
Ensembl Gene ENSMUSG00000025355
Gene Namematrix metallopeptidase 19
Synonyms
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128790910-128800824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128798856 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 447 (E447G)
Ref Sequence ENSEMBL: ENSMUSP00000026411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026411] [ENSMUST00000051011] [ENSMUST00000139227] [ENSMUST00000219404]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026411
AA Change: E447G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026411
Gene: ENSMUSG00000025355
AA Change: E447G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 26 81 6.7e-10 PFAM
ZnMc 101 258 5.13e-43 SMART
low complexity region 262 271 N/A INTRINSIC
HX 293 335 8.97e-8 SMART
HX 337 378 1e-5 SMART
HX 380 427 1.87e-5 SMART
HX 429 471 3.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051011
SMART Domains Protein: ENSMUSP00000050451
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 43 240 2.4e-47 PFAM
low complexity region 257 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139227
SMART Domains Protein: ENSMUSP00000118082
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 96 4.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152966
SMART Domains Protein: ENSMUSP00000117574
Gene: ENSMUSG00000047090

DomainStartEndE-ValueType
Pfam:DUF4203 42 241 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219404
AA Change: E375G

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219535
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. Mice lacking the encoded protein develop a diet-induced obesity due to adipocyte hypertophy, exhibit decreased susceptibility to chemical carcinogen-induced skin tumors and early onset of tumoral angiogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one knock-out allele develop diet-induced obesity due to adipocyte hypertrophy and display decreased incidence of chemically-induced fibrosarcomas while another knock-out mutant shows a reduced inflammatory reaction to contact hypersensitivity and abnormal T cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Mmp19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Mmp19 APN 10 128798142 missense probably damaging 0.99
IGL01654:Mmp19 APN 10 128798520 missense probably damaging 1.00
IGL02009:Mmp19 APN 10 128798487 missense probably benign
IGL02110:Mmp19 APN 10 128794858 missense probably damaging 0.97
H8562:Mmp19 UTSW 10 128795601 missense probably benign
I0000:Mmp19 UTSW 10 128798460 missense probably benign 0.38
R0183:Mmp19 UTSW 10 128799003 missense possibly damaging 0.49
R0388:Mmp19 UTSW 10 128798883 missense probably benign 0.01
R1481:Mmp19 UTSW 10 128798178 missense possibly damaging 0.82
R2073:Mmp19 UTSW 10 128794979 missense probably damaging 1.00
R2495:Mmp19 UTSW 10 128790950 utr 5 prime probably benign
R4477:Mmp19 UTSW 10 128795637 missense probably benign 0.01
R5293:Mmp19 UTSW 10 128791101 missense probably damaging 1.00
R6567:Mmp19 UTSW 10 128796406 missense probably benign
R6932:Mmp19 UTSW 10 128791654 missense probably benign 0.16
R7338:Mmp19 UTSW 10 128799083 missense probably benign 0.00
R7611:Mmp19 UTSW 10 128798988 missense probably benign
R8515:Mmp19 UTSW 10 128795602 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATCAGCTTCTGGAGTCC -3'
(R):5'- GGAATGTCCAAGGTTGAGCC -3'

Sequencing Primer
(F):5'- GATCAGCTTCTGGAGTCCCCTAAG -3'
(R):5'- ATGTCCAAGGTTGAGCCCATGG -3'
Posted On2014-11-12