Incidental Mutation 'R2443:Psmd12'
ID249879
Institutional Source Beutler Lab
Gene Symbol Psmd12
Ensembl Gene ENSMUSG00000020720
Gene Nameproteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms1500002F15Rik, P55
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107479484-107504362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107495737 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 378 (M378K)
Ref Sequence ENSEMBL: ENSMUSP00000021063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021063] [ENSMUST00000106750] [ENSMUST00000106752]
Predicted Effect probably damaging
Transcript: ENSMUST00000021063
AA Change: M378K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021063
Gene: ENSMUSG00000020720
AA Change: M378K

DomainStartEndE-ValueType
PINT 349 435 3.24e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106750
AA Change: M358K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102361
Gene: ENSMUSG00000020720
AA Change: M358K

DomainStartEndE-ValueType
PINT 329 415 3.24e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106752
AA Change: M378K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102363
Gene: ENSMUSG00000020720
AA Change: M378K

DomainStartEndE-ValueType
Pfam:PCI 300 398 1.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Psmd12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Psmd12 APN 11 107485781 missense probably benign 0.00
R0384:Psmd12 UTSW 11 107485721 missense probably benign 0.00
R1457:Psmd12 UTSW 11 107479646 missense probably damaging 1.00
R1661:Psmd12 UTSW 11 107491906 missense probably damaging 1.00
R3806:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3807:Psmd12 UTSW 11 107495765 missense probably benign 0.03
R3840:Psmd12 UTSW 11 107485572 missense probably benign 0.02
R4212:Psmd12 UTSW 11 107485759 missense probably damaging 1.00
R4718:Psmd12 UTSW 11 107486433 missense probably benign 0.15
R5182:Psmd12 UTSW 11 107479659 missense probably damaging 1.00
R5586:Psmd12 UTSW 11 107486475 missense probably benign 0.35
R6171:Psmd12 UTSW 11 107491907 missense probably damaging 0.96
R6444:Psmd12 UTSW 11 107486454 missense possibly damaging 0.55
R6527:Psmd12 UTSW 11 107488968 missense probably damaging 0.96
R7276:Psmd12 UTSW 11 107503645 nonsense probably null
R7466:Psmd12 UTSW 11 107492057 missense probably benign 0.03
R7751:Psmd12 UTSW 11 107479613 missense possibly damaging 0.68
R7779:Psmd12 UTSW 11 107497579 missense probably benign 0.01
R8373:Psmd12 UTSW 11 107497624 missense probably damaging 0.98
Z1177:Psmd12 UTSW 11 107485557 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GCCAGTCTTTATACCTCAGGGG -3'
(R):5'- CCTCAGACCTTTCAGTGAAGG -3'

Sequencing Primer
(F):5'- CCTCAGGGGTTAGTTTTTCTTTTGAG -3'
(R):5'- CCTTTCAGTGAAGGTCTGATTAGCAC -3'
Posted On2014-11-12