Incidental Mutation 'R2443:Strn3'
ID249880
Institutional Source Beutler Lab
Gene Symbol Strn3
Ensembl Gene ENSMUSG00000020954
Gene Namestriatin, calmodulin binding protein 3
SynonymsSG2NA
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51609632-51691897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51627835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 389 (Y389N)
Ref Sequence ENSEMBL: ENSMUSP00000130184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013130] [ENSMUST00000169503]
Predicted Effect probably damaging
Transcript: ENSMUST00000013130
AA Change: Y473N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013130
Gene: ENSMUSG00000020954
AA Change: Y473N

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 194 1.3e-50 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
low complexity region 429 446 N/A INTRINSIC
WD40 468 507 7.05e-9 SMART
WD40 521 560 2.42e-7 SMART
WD40 574 613 1.62e-8 SMART
WD40 617 659 8.25e0 SMART
WD40 670 708 2.65e1 SMART
WD40 711 750 2.32e-9 SMART
WD40 753 796 4.95e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169503
AA Change: Y389N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130184
Gene: ENSMUSG00000020954
AA Change: Y389N

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 55 N/A INTRINSIC
Pfam:Striatin 64 198 3.2e-51 PFAM
low complexity region 252 263 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
WD40 384 423 7.05e-9 SMART
WD40 437 476 2.42e-7 SMART
WD40 490 529 1.62e-8 SMART
WD40 533 575 8.25e0 SMART
WD40 586 624 2.65e1 SMART
WD40 627 666 2.32e-9 SMART
WD40 669 712 4.95e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Strn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Strn3 APN 12 51661196 missense possibly damaging 0.63
IGL00690:Strn3 APN 12 51610438 missense possibly damaging 0.96
IGL00886:Strn3 APN 12 51610150 missense probably damaging 1.00
IGL01967:Strn3 APN 12 51652813 missense probably damaging 1.00
IGL02507:Strn3 APN 12 51661627 nonsense probably null
IGL03139:Strn3 APN 12 51652850 splice site probably benign
IGL03282:Strn3 APN 12 51627209 missense probably benign 0.00
PIT4519001:Strn3 UTSW 12 51633708 missense probably benign 0.00
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0106:Strn3 UTSW 12 51621788 missense probably benign 0.01
R0336:Strn3 UTSW 12 51661608 critical splice donor site probably null
R0492:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0512:Strn3 UTSW 12 51627183 missense possibly damaging 0.94
R0610:Strn3 UTSW 12 51610448 critical splice acceptor site probably null
R0707:Strn3 UTSW 12 51610404 missense probably damaging 1.00
R0834:Strn3 UTSW 12 51627096 splice site probably benign
R1562:Strn3 UTSW 12 51633618 missense probably benign
R1599:Strn3 UTSW 12 51652766 missense possibly damaging 0.78
R1663:Strn3 UTSW 12 51652826 missense probably damaging 1.00
R1807:Strn3 UTSW 12 51627203 missense probably benign 0.10
R2263:Strn3 UTSW 12 51643223 splice site probably null
R3623:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R3624:Strn3 UTSW 12 51661216 missense possibly damaging 0.87
R4154:Strn3 UTSW 12 51627131 missense probably damaging 1.00
R4223:Strn3 UTSW 12 51627855 missense probably damaging 1.00
R4400:Strn3 UTSW 12 51648100 missense possibly damaging 0.85
R4564:Strn3 UTSW 12 51633621 missense probably benign 0.00
R4585:Strn3 UTSW 12 51650170 missense probably benign 0.02
R4755:Strn3 UTSW 12 51610216 missense possibly damaging 0.70
R4794:Strn3 UTSW 12 51650171 missense probably benign 0.38
R5288:Strn3 UTSW 12 51648020 missense probably damaging 1.00
R5308:Strn3 UTSW 12 51629385 missense probably damaging 0.99
R5765:Strn3 UTSW 12 51633627 missense probably benign
R5893:Strn3 UTSW 12 51643223 splice site probably null
R5945:Strn3 UTSW 12 51629496 missense probably benign 0.00
R6244:Strn3 UTSW 12 51610107 missense probably damaging 0.98
R6523:Strn3 UTSW 12 51643098 splice site probably null
R7437:Strn3 UTSW 12 51610163 missense probably damaging 1.00
R7545:Strn3 UTSW 12 51627760 missense probably damaging 0.98
R8299:Strn3 UTSW 12 51648107 missense probably damaging 1.00
R8337:Strn3 UTSW 12 51661172 missense probably damaging 1.00
X0024:Strn3 UTSW 12 51652709 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATAGGTTCTACATCTAAAGAGGC -3'
(R):5'- GCCCCTGGATATTTTAGTGAAACAG -3'

Sequencing Primer
(F):5'- GCACTCCTAAGAGAGAAAAGGAATG -3'
(R):5'- CCACATGCCTTTGAGCTT -3'
Posted On2014-11-12