Incidental Mutation 'R2443:Krt78'
ID249886
Institutional Source Beutler Lab
Gene Symbol Krt78
Ensembl Gene ENSMUSG00000050463
Gene Namekeratin 78
Synonyms2310030B04Rik
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101946001-101954287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101946598 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 926 (G926E)
Ref Sequence ENSEMBL: ENSMUSP00000126197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164932]
Predicted Effect probably damaging
Transcript: ENSMUST00000164932
AA Change: G926E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126197
Gene: ENSMUSG00000050463
AA Change: G926E

DomainStartEndE-ValueType
Pfam:Keratin_2_head 2 101 5.7e-16 PFAM
Filament 104 417 1.38e-133 SMART
internal_repeat_1 421 660 8.87e-74 PROSPERO
internal_repeat_1 704 957 8.87e-74 PROSPERO
low complexity region 1033 1049 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Krt78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Krt78 APN 15 101947510 missense probably benign 0.28
IGL01358:Krt78 APN 15 101946263 missense probably benign 0.18
IGL01723:Krt78 APN 15 101951798 missense possibly damaging 0.65
IGL01743:Krt78 APN 15 101950898 missense probably benign 0.06
IGL01778:Krt78 APN 15 101950967 missense probably damaging 1.00
IGL01792:Krt78 APN 15 101946650 missense probably benign 0.01
IGL02271:Krt78 APN 15 101948593 missense probably benign 0.02
IGL02481:Krt78 APN 15 101948418 splice site probably benign
IGL02494:Krt78 APN 15 101954051 missense probably benign 0.00
IGL02708:Krt78 APN 15 101953407 missense possibly damaging 0.88
IGL02747:Krt78 APN 15 101950384 splice site probably benign
IGL02997:Krt78 APN 15 101947163 missense probably benign 0.11
IGL03350:Krt78 APN 15 101946517 missense probably benign 0.02
IGL03410:Krt78 APN 15 101953986 missense probably damaging 0.99
PIT4812001:Krt78 UTSW 15 101948069 missense probably damaging 1.00
R0090:Krt78 UTSW 15 101947837 missense probably benign 0.35
R0513:Krt78 UTSW 15 101950949 missense probably damaging 1.00
R0908:Krt78 UTSW 15 101950901 missense probably damaging 1.00
R1067:Krt78 UTSW 15 101946461 nonsense probably null
R1070:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1194:Krt78 UTSW 15 101951786 missense probably damaging 0.99
R1213:Krt78 UTSW 15 101951810 missense probably benign 0.10
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1467:Krt78 UTSW 15 101946293 missense possibly damaging 0.86
R1612:Krt78 UTSW 15 101951844 splice site probably null
R1750:Krt78 UTSW 15 101946377 missense probably benign 0.33
R1796:Krt78 UTSW 15 101950865 missense probably damaging 1.00
R1863:Krt78 UTSW 15 101946569 missense possibly damaging 0.53
R1901:Krt78 UTSW 15 101946963 nonsense probably null
R1902:Krt78 UTSW 15 101946963 nonsense probably null
R1975:Krt78 UTSW 15 101946168 makesense probably null
R2105:Krt78 UTSW 15 101947414 missense possibly damaging 0.93
R2418:Krt78 UTSW 15 101946634 missense probably benign
R2421:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2422:Krt78 UTSW 15 101947264 missense probably damaging 0.96
R2897:Krt78 UTSW 15 101947106 missense probably benign
R4422:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4424:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4425:Krt78 UTSW 15 101947940 missense probably benign 0.13
R4583:Krt78 UTSW 15 101946620 missense possibly damaging 0.53
R4752:Krt78 UTSW 15 101948202 missense probably benign 0.05
R4927:Krt78 UTSW 15 101946899 missense probably benign 0.02
R5129:Krt78 UTSW 15 101947580 missense possibly damaging 0.70
R5391:Krt78 UTSW 15 101951828 nonsense probably null
R5575:Krt78 UTSW 15 101947352 nonsense probably null
R5617:Krt78 UTSW 15 101947609 missense probably damaging 0.99
R5806:Krt78 UTSW 15 101950502 missense probably damaging 1.00
R5906:Krt78 UTSW 15 101948595 missense probably damaging 0.98
R5993:Krt78 UTSW 15 101950449 missense probably damaging 1.00
R6520:Krt78 UTSW 15 101951771 missense probably benign 0.26
R6531:Krt78 UTSW 15 101952273 missense probably benign 0.03
R6587:Krt78 UTSW 15 101952269 missense probably benign 0.10
R6749:Krt78 UTSW 15 101950923 missense probably damaging 1.00
R7126:Krt78 UTSW 15 101948436 missense probably damaging 1.00
R7158:Krt78 UTSW 15 101951806 missense probably benign 0.17
R7229:Krt78 UTSW 15 101947394 missense probably benign 0.01
R7523:Krt78 UTSW 15 101946601 missense not run
R7638:Krt78 UTSW 15 101950883 missense probably damaging 1.00
R7879:Krt78 UTSW 15 101948189 missense probably benign 0.22
R8013:Krt78 UTSW 15 101948542 missense probably damaging 0.99
R8085:Krt78 UTSW 15 101947280 missense possibly damaging 0.91
R8209:Krt78 UTSW 15 101947045 missense possibly damaging 0.56
R8226:Krt78 UTSW 15 101947045 missense possibly damaging 0.56
R8309:Krt78 UTSW 15 101946487 missense probably benign 0.00
X0018:Krt78 UTSW 15 101951800 missense possibly damaging 0.96
Z1088:Krt78 UTSW 15 101947331 missense possibly damaging 0.91
Z1177:Krt78 UTSW 15 101947660 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATTCTCCTCTGGGCATGG -3'
(R):5'- AATATGGAGGCCAGGTGACC -3'

Sequencing Primer
(F):5'- TCTGGGCATGGACACTTGAC -3'
(R):5'- AGGTGACCGTGCCTAGAG -3'
Posted On2014-11-12