Mutagenetix > Incidental Mutations

Incidental Mutation 'R2443:Maats1'

249888

Institutional Source

Beutler Lab

Gene Symbol

Maats1

Ensembl Gene

ENSMUSG00000022805

Gene Name

MYCBP-associated, testis expressed 1

Synonyms

Spata26, 4932425I24Rik

MMRRC Submission

040401-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2443 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38297754-38342143 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38302732 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 645 (Y645H)

Ref Sequence

ENSEMBL: ENSMUSP00000023501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023501]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023501
AA Change: Y645H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023501
Gene: ENSMUSG00000022805
AA Change: Y645H

Domain	Start	End	E-Value	Type
Pfam:PaaSYMP	190	342	1.4e-65	PFAM
low complexity region	413	428	N/A	INTRINSIC
low complexity region	513	526	N/A	INTRINSIC
low complexity region	599	613	N/A	INTRINSIC
coiled coil region	650	682	N/A	INTRINSIC
coiled coil region	737	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133496

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	A	T	3: 108,481,349	N239K	probably damaging	Het
Anapc13	C	T	9: 102,634,023	P37S	probably damaging	Het
Asxl3	T	A	18: 22,411,539	D39E	probably benign	Het
Clec4d	G	A	6: 123,268,117	V119M	probably benign	Het
Dlx2	A	G	2: 71,546,005	S130P	probably benign	Het
Dync2li1	C	A	17: 84,647,665	Q251K	probably benign	Het
E330009J07Rik	T	C	6: 40,406,776	D444G	probably damaging	Het
Edem1	A	T	6: 108,851,269	K518N	probably benign	Het
Fbln2	T	C	6: 91,259,711	V736A	probably damaging	Het
Fga	A	G	3: 83,028,541	K25R	probably benign	Het
Hmcn1	C	A	1: 150,599,032	R4701S	probably benign	Het
Ighv8-5	G	A	12: 115,067,820	P33L	probably damaging	Het
Kcnip3	T	A	2: 127,460,063	I194F	probably damaging	Het
Kif26b	A	C	1: 178,915,014	I892L	probably damaging	Het
Krt78	C	T	15: 101,946,598	G926E	probably damaging	Het
Map1b	T	C	13: 99,430,411	Y1934C	unknown	Het
Masp1	A	T	16: 23,476,312	Y400N	probably damaging	Het
Methig1	T	C	15: 100,353,211	M1T	probably null	Het
Mmp19	A	G	10: 128,798,856	E447G	possibly damaging	Het
Ms4a6d	G	A	19: 11,590,193	H115Y	possibly damaging	Het
Myo1e	C	T	9: 70,327,172	S269L	probably benign	Het
Myo7a	G	A	7: 98,095,769	T288I	probably benign	Het
Npy5r	T	A	8: 66,681,290	K284*	probably null	Het
Oas3	C	A	5: 120,777,488	R46L	probably benign	Het
Olfr1157	A	T	2: 87,962,865	V9E	possibly damaging	Het
Pkd1l3	T	A	8: 109,623,815	S431T	probably benign	Het
Pnpla2	T	C	7: 141,458,069	V184A	possibly damaging	Het
Pomt2	C	A	12: 87,133,380	K282N	probably damaging	Het
Psmd12	T	A	11: 107,495,737	M378K	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Strn3	A	T	12: 51,627,835	Y389N	probably damaging	Het
Tdrd1	C	T	19: 56,841,354	A220V	probably null	Het
Tecpr2	T	G	12: 110,896,325	L57R	probably damaging	Het
Tkfc	A	G	19: 10,594,538	L378P	probably damaging	Het
Tmprss2	T	G	16: 97,568,503	D357A	possibly damaging	Het
Tollip	C	T	7: 141,890,823	W64*	probably null	Het
Vcan	A	G	13: 89,704,675	F722S	probably damaging	Het
Vcp	A	T	4: 42,983,385	N558K	probably damaging	Het
Vmn1r232	A	G	17: 20,913,384	I318T	probably damaging	Het
Vmn1r33	A	T	6: 66,611,973	I199K	possibly damaging	Het
Zfp61	A	G	7: 24,291,769	V319A	probably benign	Het
Zfyve28	A	G	5: 34,216,894	V592A	possibly damaging	Het

Other mutations in Maats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Maats1	APN	16	38336342	critical splice donor site	probably null
IGL02243:Maats1	APN	16	38341780	utr 5 prime	probably benign
IGL02377:Maats1	APN	16	38332819	splice site	probably benign
IGL02604:Maats1	APN	16	38321559	unclassified	probably benign
IGL02623:Maats1	APN	16	38333778	missense	possibly damaging	0.51
IGL02985:Maats1	APN	16	38298272	missense	probably damaging	0.98
IGL03389:Maats1	APN	16	38324136	critical splice donor site	probably null
PIT4280001:Maats1	UTSW	16	38332773	missense	probably benign	0.23
PIT4449001:Maats1	UTSW	16	38328358	missense	probably damaging	1.00
R0076:Maats1	UTSW	16	38302684	nonsense	probably null
R0076:Maats1	UTSW	16	38302684	nonsense	probably null
R0360:Maats1	UTSW	16	38298297	critical splice acceptor site	probably null
R0501:Maats1	UTSW	16	38335635	missense	probably damaging	1.00
R0523:Maats1	UTSW	16	38328374	missense	probably damaging	1.00
R0743:Maats1	UTSW	16	38335634	missense	possibly damaging	0.48
R0900:Maats1	UTSW	16	38336402	missense	possibly damaging	0.70
R1218:Maats1	UTSW	16	38298133	missense	probably benign
R1499:Maats1	UTSW	16	38321400	missense	probably damaging	0.96
R1693:Maats1	UTSW	16	38341723	missense	probably benign
R1793:Maats1	UTSW	16	38321419	missense	possibly damaging	0.77
R1854:Maats1	UTSW	16	38324297	splice site	probably null
R2007:Maats1	UTSW	16	38298254	missense	probably benign	0.02
R2126:Maats1	UTSW	16	38341762	missense	probably benign	0.19
R2857:Maats1	UTSW	16	38302713	missense	probably damaging	1.00
R2937:Maats1	UTSW	16	38311038	missense	possibly damaging	0.65
R3441:Maats1	UTSW	16	38333806	missense	probably benign	0.03
R3442:Maats1	UTSW	16	38333806	missense	probably benign	0.03
R4056:Maats1	UTSW	16	38298214	missense	probably benign
R4057:Maats1	UTSW	16	38298214	missense	probably benign
R4424:Maats1	UTSW	16	38320365	missense	probably damaging	1.00
R4493:Maats1	UTSW	16	38341768	missense	probably benign	0.00
R4546:Maats1	UTSW	16	38335523	missense	probably benign	0.11
R5177:Maats1	UTSW	16	38332321	missense	probably benign	0.00
R5496:Maats1	UTSW	16	38321493	missense	probably damaging	1.00
R5868:Maats1	UTSW	16	38332242	missense	probably damaging	1.00
R5944:Maats1	UTSW	16	38328310	missense	probably damaging	0.97
R6165:Maats1	UTSW	16	38333811	missense	possibly damaging	0.93
R6521:Maats1	UTSW	16	38306759	missense	probably benign	0.06
R6804:Maats1	UTSW	16	38332242	missense	probably damaging	0.97
R7086:Maats1	UTSW	16	38306857	missense	possibly damaging	0.70
R7202:Maats1	UTSW	16	38335597	missense	probably benign	0.00
R7271:Maats1	UTSW	16	38328346	missense	probably damaging	1.00
R7325:Maats1	UTSW	16	38321601	intron	probably null
R7375:Maats1	UTSW	16	38335618	missense	probably damaging	0.97
R7453:Maats1	UTSW	16	38321479	missense	possibly damaging	0.51
R7604:Maats1	UTSW	16	38298236	nonsense	probably null
R8040:Maats1	UTSW	16	38320371	missense	not run
X0062:Maats1	UTSW	16	38298099	missense	possibly damaging	0.70
X0067:Maats1	UTSW	16	38306860	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- AACATGGCTTGCAGACTGTTG -3'
(R):5'- CAGCCCCGAGTTTATGTCTC -3'

Sequencing Primer
(F):5'- CTGAATAACAGTGGCTACGACGTC -3'
(R):5'- TATGTCTCGTGCCTGGGCC -3'

Posted On

2014-11-12