Incidental Mutation 'R2443:Tmprss2'
ID249889
Institutional Source Beutler Lab
Gene Symbol Tmprss2
Ensembl Gene ENSMUSG00000000385
Gene Nametransmembrane protease, serine 2
Synonymsepitheliasin, D16Ertd61e
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97564682-97611195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 97568503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 357 (D357A)
Ref Sequence ENSEMBL: ENSMUSP00000000395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000395]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000395
AA Change: D357A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000395
Gene: ENSMUSG00000000385
AA Change: D357A

DomainStartEndE-ValueType
transmembrane domain 86 108 N/A INTRINSIC
LDLa 111 149 1e-9 SMART
SR 148 241 8.55e-10 SMART
Tryp_SPc 253 482 4.58e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232599
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Tmprss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Tmprss2 APN 16 97578595 nonsense probably null
IGL02130:Tmprss2 APN 16 97590889 missense probably damaging 1.00
IGL02149:Tmprss2 APN 16 97599279 utr 5 prime probably benign
IGL03080:Tmprss2 APN 16 97596844 missense probably damaging 0.98
PIT4480001:Tmprss2 UTSW 16 97599260 missense possibly damaging 0.77
R0395:Tmprss2 UTSW 16 97567045 missense probably damaging 1.00
R0485:Tmprss2 UTSW 16 97571994 unclassified probably benign
R1055:Tmprss2 UTSW 16 97576262 missense probably damaging 1.00
R1080:Tmprss2 UTSW 16 97591498 missense probably benign
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1930:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1931:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1955:Tmprss2 UTSW 16 97567177 critical splice acceptor site probably null
R3825:Tmprss2 UTSW 16 97596821 missense probably damaging 1.00
R4508:Tmprss2 UTSW 16 97570427 missense probably damaging 1.00
R5212:Tmprss2 UTSW 16 97576292 missense probably benign 0.00
R5571:Tmprss2 UTSW 16 97590871 missense probably null 1.00
R5715:Tmprss2 UTSW 16 97568983 missense possibly damaging 0.65
R6816:Tmprss2 UTSW 16 97568467 missense possibly damaging 0.94
R6921:Tmprss2 UTSW 16 97568437 missense probably damaging 0.98
R7230:Tmprss2 UTSW 16 97578597 missense probably benign 0.02
R7311:Tmprss2 UTSW 16 97568416 missense possibly damaging 0.94
R7788:Tmprss2 UTSW 16 97576229 nonsense probably null
R8052:Tmprss2 UTSW 16 97568416 missense probably damaging 1.00
R8329:Tmprss2 UTSW 16 97568465 missense probably benign 0.01
R8511:Tmprss2 UTSW 16 97568462 missense possibly damaging 0.94
Z1176:Tmprss2 UTSW 16 97567057 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACTGAATAACTGAACTGGGATTC -3'
(R):5'- AAGCTGCAGACACCTTTGGC -3'

Sequencing Primer
(F):5'- TTCAAATGAAGGGGTCCCACTG -3'
(R):5'- TTAATGGTACGTGAGACTCAGCCC -3'
Posted On2014-11-12