Incidental Mutation 'R2443:Vmn1r232'
ID249890
Institutional Source Beutler Lab
Gene Symbol Vmn1r232
Ensembl Gene ENSMUSG00000062165
Gene Namevomeronasal 1 receptor 232
SynonymsV1re4
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20913205-20914363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20913384 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 318 (I318T)
Ref Sequence ENSEMBL: ENSMUSP00000076261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077001]
Predicted Effect probably damaging
Transcript: ENSMUST00000077001
AA Change: I318T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076261
Gene: ENSMUSG00000062165
AA Change: I318T

DomainStartEndE-ValueType
Pfam:TAS2R 46 331 6.9e-7 PFAM
Pfam:7tm_1 70 324 1e-6 PFAM
Pfam:V1R 78 338 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232004
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Vmn1r232
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Vmn1r232 APN 17 20914132 missense probably benign 0.07
IGL02576:Vmn1r232 APN 17 20913913 missense probably benign 0.30
H8562:Vmn1r232 UTSW 17 20913394 missense probably benign 0.29
R1182:Vmn1r232 UTSW 17 20913443 missense possibly damaging 0.95
R2010:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R2088:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R2206:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2207:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2273:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2274:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2275:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R2516:Vmn1r232 UTSW 17 20914026 missense possibly damaging 0.65
R3700:Vmn1r232 UTSW 17 20914203 missense probably benign 0.29
R5256:Vmn1r232 UTSW 17 20913584 missense probably damaging 1.00
R5418:Vmn1r232 UTSW 17 20914116 missense possibly damaging 0.75
R5726:Vmn1r232 UTSW 17 20913339 missense probably benign 0.00
R5833:Vmn1r232 UTSW 17 20913651 missense probably damaging 1.00
R6528:Vmn1r232 UTSW 17 20914047 missense probably benign 0.12
R7019:Vmn1r232 UTSW 17 20913285 missense possibly damaging 0.76
R7600:Vmn1r232 UTSW 17 20913737 missense possibly damaging 0.63
R8377:Vmn1r232 UTSW 17 20913977 missense probably benign 0.00
Z1088:Vmn1r232 UTSW 17 20913838 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ACCAGTGACCCAAGTGATCTC -3'
(R):5'- GTTCTAGCACCTTCATGATTGC -3'

Sequencing Primer
(F):5'- CAGGTAAAGCAGAATCTGG -3'
(R):5'- GAGGGTTCAACACATCCTCTG -3'
Posted On2014-11-12