Incidental Mutation 'R2443:Dync2li1'
ID249891
Institutional Source Beutler Lab
Gene Symbol Dync2li1
Ensembl Gene ENSMUSG00000024253
Gene Namedynein cytoplasmic 2 light intermediate chain 1
SynonymsmD2LIC, 4933404O11Rik, LIC3, D2lic, CGI-60
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location84626496-84655558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84647665 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 251 (Q251K)
Ref Sequence ENSEMBL: ENSMUSP00000025101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025101]
Predicted Effect probably benign
Transcript: ENSMUST00000025101
AA Change: Q251K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025101
Gene: ENSMUSG00000024253
AA Change: Q251K

DomainStartEndE-ValueType
Pfam:DLIC 2 179 3.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a component of the dynein-2 microtubule motor protein complex that plays a role in the retrograde transport of cargo in primary cilia via the intraflagellar transport system. This gene is ubiquitously expressed and its protein, which localizes to the axoneme and Golgi apparatus, interacts directly with the cytoplasmic dynein 2 heavy chain 1 protein to form part of the multi-protein dynein-2 complex. Mutations in this gene produce defects in the dynein-2 complex which result in several types of ciliopathy including short-rib thoracic dysplasia 15 with polydactyly (SRTD15). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for disruptions in this allele die before embryonic day 11.5. They display neural tube defects in addition to a variety developmental patterning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Dync2li1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dync2li1 APN 17 84644726 missense possibly damaging 0.86
IGL00661:Dync2li1 APN 17 84649240 missense possibly damaging 0.88
IGL01450:Dync2li1 APN 17 84633556 missense possibly damaging 0.53
IGL01610:Dync2li1 APN 17 84628314 missense probably damaging 1.00
R0387:Dync2li1 UTSW 17 84655340 missense possibly damaging 0.69
R0883:Dync2li1 UTSW 17 84649271 missense probably benign 0.01
R1499:Dync2li1 UTSW 17 84647239 splice site probably benign
R1823:Dync2li1 UTSW 17 84649797 missense probably damaging 0.98
R2164:Dync2li1 UTSW 17 84636274 missense probably damaging 1.00
R2394:Dync2li1 UTSW 17 84644747 missense possibly damaging 0.94
R3901:Dync2li1 UTSW 17 84631642 missense probably damaging 1.00
R4151:Dync2li1 UTSW 17 84628335 missense probably benign 0.00
R4934:Dync2li1 UTSW 17 84649255 missense probably benign
R4960:Dync2li1 UTSW 17 84633541 missense probably benign 0.07
R5340:Dync2li1 UTSW 17 84649702 splice site probably null
R5841:Dync2li1 UTSW 17 84633562 missense probably damaging 1.00
R6230:Dync2li1 UTSW 17 84647650 missense probably damaging 0.97
R7331:Dync2li1 UTSW 17 84647658 nonsense probably null
R7447:Dync2li1 UTSW 17 84647713 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGTTAGTCTGTCACAACCAATGG -3'
(R):5'- ATCACAAGTACGTCAATGTGCTG -3'

Sequencing Primer
(F):5'- GTCTGTCACAACCAATGGTACTGG -3'
(R):5'- CAATGTGCTGGGAGCTTCCTC -3'
Posted On2014-11-12