Incidental Mutation 'R2443:Tkfc'
ID249893
Institutional Source Beutler Lab
Gene Symbol Tkfc
Ensembl Gene ENSMUSG00000034371
Gene Nametriokinase, FMN cyclase
SynonymsDak
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10592200-10604258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10594538 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 378 (L378P)
Ref Sequence ENSEMBL: ENSMUSP00000044556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037678]
Predicted Effect probably damaging
Transcript: ENSMUST00000037678
AA Change: L378P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371
AA Change: L378P

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Ms4a6d G A 19: 11,590,193 H115Y possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Tkfc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tkfc APN 19 10594528 missense probably benign 0.28
IGL01149:Tkfc APN 19 10600651 missense probably damaging 1.00
IGL02726:Tkfc APN 19 10596212 missense possibly damaging 0.67
IGL03069:Tkfc APN 19 10599154 missense probably benign
R1367:Tkfc UTSW 19 10593474 missense probably benign 0.19
R1476:Tkfc UTSW 19 10595326 missense probably null 0.55
R2081:Tkfc UTSW 19 10597378 missense probably damaging 1.00
R2130:Tkfc UTSW 19 10596041 missense probably damaging 0.97
R2151:Tkfc UTSW 19 10599057 missense probably damaging 1.00
R3104:Tkfc UTSW 19 10596993 nonsense probably null
R3105:Tkfc UTSW 19 10596993 nonsense probably null
R3106:Tkfc UTSW 19 10596993 nonsense probably null
R5027:Tkfc UTSW 19 10592659 splice site probably null
R5601:Tkfc UTSW 19 10594563 missense probably benign
R5637:Tkfc UTSW 19 10594533 missense probably benign 0.00
R5933:Tkfc UTSW 19 10597347 missense probably benign 0.17
R6792:Tkfc UTSW 19 10594524 missense probably benign
R6845:Tkfc UTSW 19 10599332 missense probably damaging 0.99
R6909:Tkfc UTSW 19 10596266 missense probably benign 0.06
R7007:Tkfc UTSW 19 10596363 missense probably benign
R7883:Tkfc UTSW 19 10595030 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCACGAAAGCTCCTAAATGTTC -3'
(R):5'- ATGGCCAAGGTCTCTGTGAC -3'

Sequencing Primer
(F):5'- AAAGCTCCTAAATGTTCTTGAAATTG -3'
(R):5'- TGAAGCCACTGCAGCAG -3'
Posted On2014-11-12