Incidental Mutation 'R2443:Ms4a6d'
ID249894
Institutional Source Beutler Lab
Gene Symbol Ms4a6d
Ensembl Gene ENSMUSG00000024679
Gene Namemembrane-spanning 4-domains, subfamily A, member 6D
SynonymsMs4a11
MMRRC Submission 040401-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R2443 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location11586604-11604849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11590193 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 115 (H115Y)
Ref Sequence ENSEMBL: ENSMUSP00000025582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025582] [ENSMUST00000125291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025582
AA Change: H115Y

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025582
Gene: ENSMUSG00000024679
AA Change: H115Y

DomainStartEndE-ValueType
Pfam:CD20 47 207 2.8e-42 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125291
AA Change: H7Y

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115142
Gene: ENSMUSG00000024679
AA Change: H7Y

DomainStartEndE-ValueType
Pfam:CD20 1 99 3.7e-15 PFAM
low complexity region 114 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155669
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,481,349 N239K probably damaging Het
Anapc13 C T 9: 102,634,023 P37S probably damaging Het
Asxl3 T A 18: 22,411,539 D39E probably benign Het
Clec4d G A 6: 123,268,117 V119M probably benign Het
Dlx2 A G 2: 71,546,005 S130P probably benign Het
Dync2li1 C A 17: 84,647,665 Q251K probably benign Het
E330009J07Rik T C 6: 40,406,776 D444G probably damaging Het
Edem1 A T 6: 108,851,269 K518N probably benign Het
Fbln2 T C 6: 91,259,711 V736A probably damaging Het
Fga A G 3: 83,028,541 K25R probably benign Het
Hmcn1 C A 1: 150,599,032 R4701S probably benign Het
Ighv8-5 G A 12: 115,067,820 P33L probably damaging Het
Kcnip3 T A 2: 127,460,063 I194F probably damaging Het
Kif26b A C 1: 178,915,014 I892L probably damaging Het
Krt78 C T 15: 101,946,598 G926E probably damaging Het
Maats1 A G 16: 38,302,732 Y645H probably damaging Het
Map1b T C 13: 99,430,411 Y1934C unknown Het
Masp1 A T 16: 23,476,312 Y400N probably damaging Het
Methig1 T C 15: 100,353,211 M1T probably null Het
Mmp19 A G 10: 128,798,856 E447G possibly damaging Het
Myo1e C T 9: 70,327,172 S269L probably benign Het
Myo7a G A 7: 98,095,769 T288I probably benign Het
Npy5r T A 8: 66,681,290 K284* probably null Het
Oas3 C A 5: 120,777,488 R46L probably benign Het
Olfr1157 A T 2: 87,962,865 V9E possibly damaging Het
Pkd1l3 T A 8: 109,623,815 S431T probably benign Het
Pnpla2 T C 7: 141,458,069 V184A possibly damaging Het
Pomt2 C A 12: 87,133,380 K282N probably damaging Het
Psmd12 T A 11: 107,495,737 M378K probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Strn3 A T 12: 51,627,835 Y389N probably damaging Het
Tdrd1 C T 19: 56,841,354 A220V probably null Het
Tecpr2 T G 12: 110,896,325 L57R probably damaging Het
Tkfc A G 19: 10,594,538 L378P probably damaging Het
Tmprss2 T G 16: 97,568,503 D357A possibly damaging Het
Tollip C T 7: 141,890,823 W64* probably null Het
Vcan A G 13: 89,704,675 F722S probably damaging Het
Vcp A T 4: 42,983,385 N558K probably damaging Het
Vmn1r232 A G 17: 20,913,384 I318T probably damaging Het
Vmn1r33 A T 6: 66,611,973 I199K possibly damaging Het
Zfp61 A G 7: 24,291,769 V319A probably benign Het
Zfyve28 A G 5: 34,216,894 V592A possibly damaging Het
Other mutations in Ms4a6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ms4a6d APN 19 11601885 missense probably damaging 0.99
IGL01638:Ms4a6d APN 19 11587168 missense probably damaging 0.99
IGL01799:Ms4a6d APN 19 11590135 missense probably damaging 1.00
IGL02304:Ms4a6d APN 19 11603141 splice site probably benign
R1873:Ms4a6d UTSW 19 11601859 missense probably damaging 1.00
R1993:Ms4a6d UTSW 19 11590159 missense probably damaging 1.00
R2900:Ms4a6d UTSW 19 11590144 missense probably damaging 1.00
R5288:Ms4a6d UTSW 19 11587136 missense possibly damaging 0.78
R6251:Ms4a6d UTSW 19 11587140 missense probably damaging 0.99
R7339:Ms4a6d UTSW 19 11590073 nonsense probably null
R7340:Ms4a6d UTSW 19 11590073 nonsense probably null
R7341:Ms4a6d UTSW 19 11590073 nonsense probably null
R7342:Ms4a6d UTSW 19 11590073 nonsense probably null
R7347:Ms4a6d UTSW 19 11590073 nonsense probably null
R7348:Ms4a6d UTSW 19 11590073 nonsense probably null
R7350:Ms4a6d UTSW 19 11590073 nonsense probably null
R7368:Ms4a6d UTSW 19 11590073 nonsense probably null
R7393:Ms4a6d UTSW 19 11590073 nonsense probably null
R7394:Ms4a6d UTSW 19 11590073 nonsense probably null
R8020:Ms4a6d UTSW 19 11590108 missense probably benign 0.00
R8181:Ms4a6d UTSW 19 11603289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACAGTCAGAGCAGCTTTGG -3'
(R):5'- CTGAAGTACTGTCTGGCATGGG -3'

Sequencing Primer
(F):5'- CACGAAGCAGCTGTTTAATGGCTC -3'
(R):5'- AAGTACTGTCTGGCATGGGATCATAC -3'
Posted On2014-11-12