Incidental Mutation 'R2444:Kcnb2'
ID 249896
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms 9630047L19Rik, Kv2.2
MMRRC Submission 040402-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2444 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 15287254-15723750 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15709567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 221 (N221I)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably benign
Transcript: ENSMUST00000170146
AA Change: N221I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000175681
AA Change: N221I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: N221I

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fam184a A C 10: 53,640,949 L410R probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Fgf15 A G 7: 144,899,692 D134G probably benign Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Mtnr1a C T 8: 45,087,658 Q219* probably null Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Olfr849 T A 9: 19,441,015 I34K possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15710613 missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15711499 missense probably benign
R9321:Kcnb2 UTSW 1 15709569 missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15709513 missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15711220 missense probably benign
R9709:Kcnb2 UTSW 1 15710299 missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CGTGTTCTCTATCATTCAAAGAACC -3'
(R):5'- ATTCTGGAACTGCAGCACAC -3'

Sequencing Primer
(F):5'- CCACCAAAGCATGTGTGGTTG -3'
(R):5'- GGAACTGCAGCACACTTTTG -3'
Posted On 2014-11-12