Incidental Mutation 'R2444:Fgf15'
ID 249913
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Name fibroblast growth factor 15
Synonyms FGF19
MMRRC Submission 040402-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2444 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 144450269-144454690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144453429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 134 (D134G)
Ref Sequence ENSEMBL: ENSMUSP00000033389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
AlphaFold O35622
Predicted Effect probably benign
Transcript: ENSMUST00000033389
AA Change: D134G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: D134G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207040
Predicted Effect probably benign
Transcript: ENSMUST00000207229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208515
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 78,904,561 (GRCm39) D112E possibly damaging Het
Abca15 A G 7: 119,965,120 (GRCm39) Y794C probably damaging Het
Bicd2 T C 13: 49,532,500 (GRCm39) V362A probably benign Het
Cep126 G A 9: 8,101,307 (GRCm39) T409M probably damaging Het
Cep131 A G 11: 119,961,321 (GRCm39) F610S probably damaging Het
Cfap61 T C 2: 145,877,239 (GRCm39) probably null Het
Chd1l A G 3: 97,497,882 (GRCm39) Y320H probably damaging Het
Dnajc30 A G 5: 135,093,439 (GRCm39) D112G probably damaging Het
Dync2i1 T C 12: 116,196,289 (GRCm39) D486G possibly damaging Het
Fam184a A C 10: 53,517,045 (GRCm39) L410R probably damaging Het
Fat2 T C 11: 55,172,799 (GRCm39) N2638S probably damaging Het
Flywch2 A T 17: 23,996,024 (GRCm39) S124R possibly damaging Het
Gabra5 G A 7: 57,058,623 (GRCm39) T375I probably benign Het
Gpat3 C T 5: 101,005,039 (GRCm39) P58L probably benign Het
Hltf T A 3: 20,118,071 (GRCm39) N44K possibly damaging Het
Hoatz A G 9: 51,011,298 (GRCm39) probably null Het
Kcnb2 A T 1: 15,779,791 (GRCm39) N221I probably benign Het
Marco G A 1: 120,422,499 (GRCm39) T61M probably damaging Het
Med13 A G 11: 86,222,786 (GRCm39) I180T probably damaging Het
Mei1 C T 15: 81,997,142 (GRCm39) T626M probably damaging Het
Mtnr1a C T 8: 45,540,695 (GRCm39) Q219* probably null Het
Nav3 A G 10: 109,600,776 (GRCm39) S1284P probably benign Het
Or1j10 T C 2: 36,267,625 (GRCm39) V279A possibly damaging Het
Or7g30 T A 9: 19,352,311 (GRCm39) I34K possibly damaging Het
Pcdh9 T A 14: 94,124,227 (GRCm39) T648S probably benign Het
Proz A T 8: 13,111,027 (GRCm39) probably benign Het
Rec114 G T 9: 58,567,602 (GRCm39) A128E probably damaging Het
Rspry1 G T 8: 95,349,735 (GRCm39) G41V probably damaging Het
Sbf2 A T 7: 109,929,905 (GRCm39) M1388K probably benign Het
Spice1 C T 16: 44,186,931 (GRCm39) Q143* probably null Het
Tcstv3 A T 13: 120,779,365 (GRCm39) K88M probably damaging Het
Terb2 T A 2: 122,023,788 (GRCm39) probably null Het
Tmx3 A T 18: 90,558,307 (GRCm39) K453M probably damaging Het
Tnc T C 4: 63,933,200 (GRCm39) Y688C probably damaging Het
Tshz2 T G 2: 169,726,726 (GRCm39) S441A probably benign Het
Usp45 A T 4: 21,817,528 (GRCm39) M399L probably benign Het
Vmn2r82 A T 10: 79,213,702 (GRCm39) H96L possibly damaging Het
Wls G A 3: 159,612,867 (GRCm39) R261Q probably damaging Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144,453,629 (GRCm39) missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144,450,672 (GRCm39) splice site probably null
R1690:Fgf15 UTSW 7 144,453,665 (GRCm39) missense probably damaging 1.00
R5073:Fgf15 UTSW 7 144,450,576 (GRCm39) missense possibly damaging 0.94
R6149:Fgf15 UTSW 7 144,453,506 (GRCm39) nonsense probably null
R7287:Fgf15 UTSW 7 144,450,531 (GRCm39) missense probably benign 0.27
R7396:Fgf15 UTSW 7 144,453,542 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTGGGATGAGCCAACAATCTC -3'
(R):5'- GGCAGGGAGAACATTTTAGACC -3'

Sequencing Primer
(F):5'- ATGGTAGTCGAGCTCAGCCATG -3'
(R):5'- GGAGAACATTTTAGACCTCAGCTG -3'
Posted On 2014-11-12