Incidental Mutation 'R2444:Fgf15'
ID249913
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Namefibroblast growth factor 15
SynonymsFGF19
MMRRC Submission 040402-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2444 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location144896531-144900953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144899692 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 134 (D134G)
Ref Sequence ENSEMBL: ENSMUSP00000033389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
Predicted Effect probably benign
Transcript: ENSMUST00000033389
AA Change: D134G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: D134G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207040
Predicted Effect probably benign
Transcript: ENSMUST00000207229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208515
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fam184a A C 10: 53,640,949 L410R probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Kcnb2 A T 1: 15,709,567 N221I probably benign Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Mtnr1a C T 8: 45,087,658 Q219* probably null Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Olfr849 T A 9: 19,441,015 I34K possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144899892 missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144896935 splice site probably null
R1690:Fgf15 UTSW 7 144899928 missense probably damaging 1.00
R5073:Fgf15 UTSW 7 144896839 missense possibly damaging 0.94
R6149:Fgf15 UTSW 7 144899769 nonsense probably null
R7287:Fgf15 UTSW 7 144896794 missense probably benign 0.27
R7396:Fgf15 UTSW 7 144899805 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTGGGATGAGCCAACAATCTC -3'
(R):5'- GGCAGGGAGAACATTTTAGACC -3'

Sequencing Primer
(F):5'- ATGGTAGTCGAGCTCAGCCATG -3'
(R):5'- GGAGAACATTTTAGACCTCAGCTG -3'
Posted On2014-11-12