Incidental Mutation 'R2444:Mtnr1a'
ID249915
Institutional Source Beutler Lab
Gene Symbol Mtnr1a
Ensembl Gene ENSMUSG00000054764
Gene Namemelatonin receptor 1A
SynonymsMelR, Mel1a receptor
MMRRC Submission 040402-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2444 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45069137-45088506 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 45087658 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 219 (Q219*)
Ref Sequence ENSEMBL: ENSMUSP00000069872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067984]
Predicted Effect probably null
Transcript: ENSMUST00000067984
AA Change: Q219*
SMART Domains Protein: ENSMUSP00000069872
Gene: ENSMUSG00000054764
AA Change: Q219*

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 315 1.8e-11 PFAM
Pfam:7TM_GPCR_Srsx 41 313 2.5e-10 PFAM
Pfam:7tm_1 47 298 5.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130141
SMART Domains Protein: ENSMUSP00000115764
Gene: ENSMUSG00000054764

DomainStartEndE-ValueType
Pfam:7tm_1 23 92 6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209488
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two high affinity forms of a receptor for melatonin, the primary hormone secreted by the pineal gland. This receptor is a G-protein coupled, 7-transmembrane receptor that is responsible for melatonin effects on mammalian circadian rhythm and reproductive alterations affected by day length. The receptor is an integral membrane protein that is readily detectable and localized to two specific regions of the brain. The hypothalamic suprachiasmatic nucleus appears to be involved in circadian rhythm while the hypophysial pars tuberalis may be responsible for the reproductive effects of melatonin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal, with normal circadian functions. In vitro studies report the absence of inhibitory effects of melatonin on suprachiasma neuronal firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fam184a A C 10: 53,640,949 L410R probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Fgf15 A G 7: 144,899,692 D134G probably benign Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Kcnb2 A T 1: 15,709,567 N221I probably benign Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Olfr849 T A 9: 19,441,015 I34K possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in Mtnr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02965:Mtnr1a APN 8 45069382 missense probably damaging 0.97
IGL03230:Mtnr1a APN 8 45087398 missense probably damaging 1.00
R0149:Mtnr1a UTSW 8 45069315 missense probably benign
R0744:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0833:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0836:Mtnr1a UTSW 8 45087937 missense probably benign 0.27
R0856:Mtnr1a UTSW 8 45087833 missense possibly damaging 0.86
R1445:Mtnr1a UTSW 8 45087745 missense probably benign 0.27
R1983:Mtnr1a UTSW 8 45087434 missense probably benign 0.01
R2884:Mtnr1a UTSW 8 45087268 missense probably benign 0.00
R3947:Mtnr1a UTSW 8 45087520 missense probably damaging 1.00
R4829:Mtnr1a UTSW 8 45085615 intron probably benign
R5681:Mtnr1a UTSW 8 45087937 missense possibly damaging 0.47
R7908:Mtnr1a UTSW 8 45087826 missense probably benign 0.22
R7989:Mtnr1a UTSW 8 45087826 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TATGGATGCTGACACTCATCGC -3'
(R):5'- GCCAGGTAGTAACTAGCCAC -3'

Sequencing Primer
(F):5'- GCTGACACTCATCGCCATCATG -3'
(R):5'- GGTAGTAACTAGCCACGAACAGC -3'
Posted On2014-11-12