Incidental Mutation 'R2444:Fam184a'
ID249921
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission 040402-MU
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R2444 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53640949 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 410 (L410R)
Ref Sequence ENSEMBL: ENSMUSP00000151789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000164393] [ENSMUST00000169866] [ENSMUST00000171807] [ENSMUST00000217939] [ENSMUST00000218659] [ENSMUST00000218682]
Predicted Effect probably damaging
Transcript: ENSMUST00000020003
AA Change: L1013R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: L1013R

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163761
AA Change: L908R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: L908R

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164393
Predicted Effect unknown
Transcript: ENSMUST00000165986
AA Change: L265R
SMART Domains Protein: ENSMUSP00000128132
Gene: ENSMUSG00000019856
AA Change: L265R

DomainStartEndE-ValueType
coiled coil region 9 40 N/A INTRINSIC
coiled coil region 102 166 N/A INTRINSIC
coiled coil region 212 235 N/A INTRINSIC
low complexity region 354 366 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168949
Predicted Effect probably damaging
Transcript: ENSMUST00000169866
AA Change: L71R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128426
Gene: ENSMUSG00000019856
AA Change: L71R

DomainStartEndE-ValueType
coiled coil region 18 41 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171807
AA Change: L560R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856
AA Change: L560R

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217939
AA Change: L121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218659
AA Change: L236R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218682
AA Change: L410R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218780
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik A T 10: 79,068,727 D112E possibly damaging Het
4833427G06Rik A G 9: 51,099,998 probably null Het
Abca15 A G 7: 120,365,897 Y794C probably damaging Het
Bicd2 T C 13: 49,379,024 V362A probably benign Het
Cep126 G A 9: 8,101,306 T409M probably damaging Het
Cep131 A G 11: 120,070,495 F610S probably damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Chd1l A G 3: 97,590,566 Y320H probably damaging Het
Dnajc30 A G 5: 135,064,585 D112G probably damaging Het
Fat2 T C 11: 55,281,973 N2638S probably damaging Het
Fgf15 A G 7: 144,899,692 D134G probably benign Het
Flywch2 A T 17: 23,777,050 S124R possibly damaging Het
Gabra5 G A 7: 57,408,875 T375I probably benign Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hltf T A 3: 20,063,907 N44K possibly damaging Het
Kcnb2 A T 1: 15,709,567 N221I probably benign Het
Marco G A 1: 120,494,770 T61M probably damaging Het
Med13 A G 11: 86,331,960 I180T probably damaging Het
Mei1 C T 15: 82,112,941 T626M probably damaging Het
Mtnr1a C T 8: 45,087,658 Q219* probably null Het
Nav3 A G 10: 109,764,915 S1284P probably benign Het
Olfr338 T C 2: 36,377,613 V279A possibly damaging Het
Olfr849 T A 9: 19,441,015 I34K possibly damaging Het
Pcdh9 T A 14: 93,886,791 T648S probably benign Het
Proz A T 8: 13,061,027 probably benign Het
Rec114 G T 9: 58,660,319 A128E probably damaging Het
Rspry1 G T 8: 94,623,107 G41V probably damaging Het
Sbf2 A T 7: 110,330,698 M1388K probably benign Het
Spice1 C T 16: 44,366,568 Q143* probably null Het
Tcstv3 A T 13: 120,317,829 K88M probably damaging Het
Terb2 T A 2: 122,193,307 probably null Het
Tmx3 A T 18: 90,540,183 K453M probably damaging Het
Tnc T C 4: 64,014,963 Y688C probably damaging Het
Tshz2 T G 2: 169,884,806 S441A probably benign Het
Usp45 A T 4: 21,817,528 M399L probably benign Het
Vmn2r82 A T 10: 79,377,868 H96L possibly damaging Het
Wdr60 T C 12: 116,232,669 D486G possibly damaging Het
Wls G A 3: 159,907,230 R261Q probably damaging Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1422:Fam184a UTSW 10 53675208 missense probably benign 0.29
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7964:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7969:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7979:Fam184a UTSW 10 53633706 nonsense probably null
R7980:Fam184a UTSW 10 53633706 nonsense probably null
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGTAAAATTCCCTTATTCTGATGCC -3'
(R):5'- CAAGGCTTACCGTAAATCTGC -3'

Sequencing Primer
(F):5'- GCTTAATAAACGTGCCCA -3'
(R):5'- CCGTAAATCTGCGTGTGTTTAAC -3'
Posted On2014-11-12