Incidental Mutation 'R2410:Lrrc39'
ID249942
Institutional Source Beutler Lab
Gene Symbol Lrrc39
Ensembl Gene ENSMUSG00000027961
Gene Nameleucine rich repeat containing 39
Synonyms2010005E21Rik, 9430028I06Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116562973-116583134 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116581250 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 327 (P327S)
Ref Sequence ENSEMBL: ENSMUSP00000029573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029573] [ENSMUST00000041524] [ENSMUST00000183638] [ENSMUST00000184963] [ENSMUST00000197190]
Predicted Effect probably benign
Transcript: ENSMUST00000029573
AA Change: P327S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029573
Gene: ENSMUSG00000027961
AA Change: P327S

DomainStartEndE-ValueType
LRR 105 127 1.15e1 SMART
LRR_TYP 128 151 7.26e-3 SMART
LRR 175 197 6.58e0 SMART
LRR 198 220 1e1 SMART
LRR 221 243 7.16e0 SMART
LRR 244 267 6.58e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041524
SMART Domains Protein: ENSMUSP00000047320
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 17 45 7.2e-17 PFAM
Pfam:zf-U11-48K 56 80 3.4e-12 PFAM
Pfam:TRM13 165 469 7e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156161
Predicted Effect probably benign
Transcript: ENSMUST00000183638
SMART Domains Protein: ENSMUSP00000139223
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 1.4e-17 PFAM
Pfam:zf-U11-48K 55 81 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184963
SMART Domains Protein: ENSMUSP00000138868
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:zf-TRM13_CCCH 16 46 2.9e-17 PFAM
Pfam:zf-U11-48K 55 81 2.3e-12 PFAM
Pfam:TRM13 165 285 3.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197190
SMART Domains Protein: ENSMUSP00000143637
Gene: ENSMUSG00000033439

DomainStartEndE-ValueType
Pfam:TRM13 116 179 5.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199439
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Lrrc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrrc39 APN 3 116570981 splice site probably benign
IGL01017:Lrrc39 APN 3 116570851 missense probably benign 0.01
IGL01717:Lrrc39 APN 3 116579497 unclassified probably benign
IGL01728:Lrrc39 APN 3 116579500 unclassified probably benign
IGL02208:Lrrc39 APN 3 116578274 missense probably damaging 1.00
IGL02801:Lrrc39 APN 3 116578346 missense possibly damaging 0.89
R0279:Lrrc39 UTSW 3 116578303 missense probably benign 0.19
R1351:Lrrc39 UTSW 3 116565820 missense possibly damaging 0.51
R1436:Lrrc39 UTSW 3 116579644 splice site probably null
R1641:Lrrc39 UTSW 3 116570913 missense probably damaging 0.99
R1716:Lrrc39 UTSW 3 116579567 missense probably benign 0.00
R2199:Lrrc39 UTSW 3 116570961 missense probably damaging 0.97
R4696:Lrrc39 UTSW 3 116570120 missense probably damaging 1.00
R4816:Lrrc39 UTSW 3 116568866 critical splice donor site probably null
R5076:Lrrc39 UTSW 3 116579540 missense probably benign 0.37
R6152:Lrrc39 UTSW 3 116570975 critical splice donor site probably null
R7124:Lrrc39 UTSW 3 116565913 missense probably benign
X0028:Lrrc39 UTSW 3 116565871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCACACTCAGATTGATCC -3'
(R):5'- ACCCATTGGTGTCTCTGGAAAAC -3'

Sequencing Primer
(F):5'- GATTAATACACAGAGTTCACAC -3'
(R):5'- ACGTATTATTAACTGCCGTACCAGC -3'
Posted On2014-11-12