Incidental Mutation 'R2410:Tmem255b'
ID249952
Institutional Source Beutler Lab
Gene Symbol Tmem255b
Ensembl Gene ENSMUSG00000038457
Gene Nametransmembrane protein 255B
SynonymsFam70b, LOC272465
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location13435189-13468473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13441278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 66 (I66V)
Ref Sequence ENSEMBL: ENSMUSP00000127421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167071] [ENSMUST00000167505] [ENSMUST00000210804]
Predicted Effect probably benign
Transcript: ENSMUST00000167071
AA Change: I66V

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127421
Gene: ENSMUSG00000038457
AA Change: I66V

DomainStartEndE-ValueType
Pfam:FAM70 1 68 8.2e-28 PFAM
Pfam:FAM70 66 307 1.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167505
AA Change: I66V

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130504
Gene: ENSMUSG00000038457
AA Change: I66V

DomainStartEndE-ValueType
Pfam:FAM70 6 328 6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211356
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Fzd2 A G 11: 102,605,627 Y299C possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Tmem255b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Tmem255b APN 8 13457054 missense probably benign
IGL02635:Tmem255b APN 8 13455195 missense probably damaging 1.00
IGL02679:Tmem255b APN 8 13457055 missense probably benign 0.04
IGL02945:Tmem255b APN 8 13455141 missense probably damaging 0.98
IGL03007:Tmem255b APN 8 13457066 missense possibly damaging 0.94
IGL03146:Tmem255b APN 8 13454174 missense probably damaging 1.00
R2278:Tmem255b UTSW 8 13451081 missense probably damaging 1.00
R3081:Tmem255b UTSW 8 13451048 missense probably damaging 0.99
R4498:Tmem255b UTSW 8 13455998 missense probably damaging 1.00
R4612:Tmem255b UTSW 8 13454228 missense probably benign 0.00
R6018:Tmem255b UTSW 8 13455138 missense probably benign 0.00
R6073:Tmem255b UTSW 8 13456958 missense probably damaging 0.98
R6240:Tmem255b UTSW 8 13454216 missense probably damaging 1.00
R6737:Tmem255b UTSW 8 13457096 critical splice donor site probably null
R8231:Tmem255b UTSW 8 13454225 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTGGGTAATTAGCCCTCAG -3'
(R):5'- AACACTGGCCTGCGAACATG -3'

Sequencing Primer
(F):5'- CCTCAGCTCACCAATACCTTTC -3'
(R):5'- TTAGGGCCCTCTAACCAGCAG -3'
Posted On2014-11-12