Incidental Mutation 'R2410:Fzd2'
ID249957
Institutional Source Beutler Lab
Gene Symbol Fzd2
Ensembl Gene ENSMUSG00000050288
Gene Namefrizzled class receptor 2
SynonymsMfz10a, Fz10, Mfz10
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R2410 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102604396-102608058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102605627 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 299 (Y299C)
Ref Sequence ENSEMBL: ENSMUSP00000091463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057893
AA Change: Y299C

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091463
Gene: ENSMUSG00000050288
AA Change: Y299C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FRI 43 160 7.47e-74 SMART
low complexity region 176 195 N/A INTRINSIC
Frizzled 239 563 3.32e-218 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is a member of the frizzled gene family. Members of this family encode seven-transmembrane domain proteins that are receptors for the wingless type MMTV integration site family of signaling proteins. This gene encodes a protein that is coupled to the beta-catenin canonical signaling pathway. Competition between the wingless-type MMTV integration site family, member 3A and wingless-type MMTV integration site family, member 5A gene products for binding of this protein is thought to regulate the beta-catenin-dependent and -independent pathways. [provided by RefSeq, Dec 2010]
PHENOTYPE: About 50% of mice homozygous for a reporter allele display a cleft palate and die as neonates; the remaining 50% survive exhibiting a variable degree of postnatal runting and reduced olfactory sensitivity to various odorants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Adgrf5 C A 17: 43,455,266 N1326K probably benign Het
Ciita A G 16: 10,510,704 E284G probably damaging Het
Ctbp2 T C 7: 133,014,354 Y284C probably benign Het
Dnah11 T C 12: 118,027,527 D2368G probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Erich3 A G 3: 154,733,603 D491G probably damaging Het
Ero1l C T 14: 45,305,266 V101I possibly damaging Het
Fbxl7 A G 15: 26,895,025 Y9H possibly damaging Het
Lamc1 G A 1: 153,247,395 T683M possibly damaging Het
Lrrc39 C T 3: 116,581,250 P327S probably benign Het
Marf1 A T 16: 14,115,827 F1566I probably benign Het
Me2 A T 18: 73,791,112 M343K probably damaging Het
Mlxip T A 5: 123,443,069 W260R probably damaging Het
Mrps17 T C 5: 129,717,983 V64A probably damaging Het
Olfr1223 A T 2: 89,144,555 I156N possibly damaging Het
Phldb3 C T 7: 24,624,294 S450L probably benign Het
Pi4k2a A G 19: 42,104,877 E219G possibly damaging Het
Polr1a T C 6: 71,974,882 S1478P probably benign Het
Rab14 T C 2: 35,186,750 probably null Het
Rnf43 T C 11: 87,732,259 Y729H possibly damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Sorbs1 T A 19: 40,373,515 I142F probably damaging Het
Tmem255b A G 8: 13,441,278 I66V probably benign Het
Vmn2r9 T C 5: 108,848,257 D175G probably damaging Het
Zfp954 A T 7: 7,117,809 I74N probably benign Het
Other mutations in Fzd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Fzd2 APN 11 102605782 missense possibly damaging 0.94
IGL02034:Fzd2 APN 11 102604904 missense probably damaging 1.00
IGL02035:Fzd2 APN 11 102606444 makesense probably null
PIT4585001:Fzd2 UTSW 11 102605747 missense probably damaging 0.99
R0201:Fzd2 UTSW 11 102606122 missense probably damaging 1.00
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1146:Fzd2 UTSW 11 102605380 missense possibly damaging 0.76
R1530:Fzd2 UTSW 11 102605308 missense probably benign 0.00
R1589:Fzd2 UTSW 11 102606328 missense probably benign 0.06
R1676:Fzd2 UTSW 11 102605881 missense probably damaging 1.00
R2057:Fzd2 UTSW 11 102605933 missense probably damaging 1.00
R2219:Fzd2 UTSW 11 102605423 missense probably benign 0.01
R5058:Fzd2 UTSW 11 102604807 missense probably damaging 0.99
R5296:Fzd2 UTSW 11 102606155 missense probably damaging 0.96
R5580:Fzd2 UTSW 11 102605839 missense probably damaging 0.99
R5788:Fzd2 UTSW 11 102605467 missense probably benign 0.03
R6104:Fzd2 UTSW 11 102606335 missense probably damaging 1.00
R6452:Fzd2 UTSW 11 102604985 missense probably damaging 1.00
R7454:Fzd2 UTSW 11 102605129 missense probably damaging 1.00
R7774:Fzd2 UTSW 11 102605488 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGCTCTATGTTCTTCTCGCAAG -3'
(R):5'- ACTGCGAATTGGCCTCGATG -3'

Sequencing Primer
(F):5'- TCACGGTCACCACCTATT -3'
(R):5'- TCATTCCGGCTGCCAGGAAC -3'
Posted On2014-11-12