Incidental Mutation 'R2411:Lilra6'
ID249985
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
SynonymsPira3, 7M1
MMRRC Submission 040376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2411 (G1)
Quality Score181
Status Validated
Chromosome7
Chromosomal Location3908280-3915503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3911454 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 566 (Y566C)
Ref Sequence ENSEMBL: ENSMUSP00000088188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
Predicted Effect probably damaging
Transcript: ENSMUST00000038176
AA Change: Y604C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: Y604C

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090689
AA Change: Y566C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: Y566C

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131255
Predicted Effect probably damaging
Transcript: ENSMUST00000206077
AA Change: Y264C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206851
Meta Mutation Damage Score 0.3459 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acad11 T G 9: 104,086,023 probably benign Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Btbd16 T C 7: 130,790,224 F160L probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Olfr301 T C 7: 86,413,082 V281A possibly damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
R8056:Lilra6 UTSW 7 3912552 missense probably damaging 1.00
Z1176:Lilra6 UTSW 7 3915074 critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3912581 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TATCCTGTTATGTGCTGACGAATG -3'
(R):5'- TGCAGCCTAACCACACAGTG -3'

Sequencing Primer
(F):5'- GCTGACGAATGTGCCTATGTCTAAC -3'
(R):5'- CAGTGCACTCAGGAGAGACC -3'
Posted On2014-11-12