Incidental Mutation 'R2411:Olfr301'
ID249990
Institutional Source Beutler Lab
Gene Symbol Olfr301
Ensembl Gene ENSMUSG00000061549
Gene Nameolfactory receptor 301
SynonymsOlfr1531-ps1, MOR211-8P, GA_x6K02T2NHDJ-9693313-9692378, MOR221-1P, MOR221-1P, MOR221-4
MMRRC Submission 040376-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86403846-86414024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86413082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 281 (V281A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073222
AA Change: V281A

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072955
Gene: ENSMUSG00000061549
AA Change: V281A

DomainStartEndE-ValueType
Pfam:7tm_4 70 348 4.7e-46 PFAM
Pfam:7tm_1 80 330 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174362
AA Change: V240A

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133780
Gene: ENSMUSG00000061549
AA Change: V240A

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
Pfam:7tm_1 39 289 2e-28 PFAM
Pfam:7tm_4 137 282 1.1e-40 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acad11 T G 9: 104,086,023 probably benign Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Btbd16 T C 7: 130,790,224 F160L probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lilra6 T C 7: 3,911,454 Y566C probably damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Olfr301
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr301 APN 7 86412790 missense probably damaging 1.00
IGL01459:Olfr301 APN 7 86412551 missense probably damaging 1.00
IGL01538:Olfr301 APN 7 86412959 missense possibly damaging 0.80
IGL01547:Olfr301 APN 7 86412871 missense possibly damaging 0.94
R0918:Olfr301 UTSW 7 86413195 missense probably benign 0.01
R1559:Olfr301 UTSW 7 86412367 missense probably benign 0.00
R1651:Olfr301 UTSW 7 86407870 utr 5 prime probably benign
R3732:Olfr301 UTSW 7 86412633 missense probably damaging 0.98
R3832:Olfr301 UTSW 7 86413193 missense probably damaging 1.00
R5175:Olfr301 UTSW 7 86413046 missense probably benign 0.00
R5372:Olfr301 UTSW 7 86412968 missense possibly damaging 0.66
R5413:Olfr301 UTSW 7 86412467 missense probably benign
R5520:Olfr301 UTSW 7 86412856 missense probably benign 0.02
R5579:Olfr301 UTSW 7 86412726 nonsense probably null
R6037:Olfr301 UTSW 7 86413270 missense probably benign 0.02
R6037:Olfr301 UTSW 7 86413270 missense probably benign 0.02
R7251:Olfr301 UTSW 7 86413001 missense probably benign
R7340:Olfr301 UTSW 7 86412749 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATTGCTGAGGCTTTCTTGC -3'
(R):5'- GGAATGTGTGAGTATACGTGCAC -3'

Sequencing Primer
(F):5'- GCTGAGGCTTTCTTGCTCTGATAC -3'
(R):5'- AGTTCTATTCCTCTAGAGAACCCTG -3'
Posted On2014-11-12