Incidental Mutation 'R2411:Btbd16'
ID249992
Institutional Source Beutler Lab
Gene Symbol Btbd16
Ensembl Gene ENSMUSG00000040298
Gene NameBTB (POZ) domain containing 16
SynonymsE330040A16Rik
MMRRC Submission 040376-MU
Accession Numbers

Genbank: NM_001081038.2; Ensembl: ENSMUST00000048453

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2411 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130774069-130825899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130790224 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 160 (F160L)
Ref Sequence ENSEMBL: ENSMUSP00000146849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048453] [ENSMUST00000124096] [ENSMUST00000207219] [ENSMUST00000208593]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048453
AA Change: F176L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035433
Gene: ENSMUSG00000040298
AA Change: F176L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
Blast:BTB 97 222 3e-47 BLAST
SCOP:d1buoa_ 154 218 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207155
Predicted Effect probably damaging
Transcript: ENSMUST00000207219
AA Change: F176L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208593
AA Change: F160L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2922 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a BTB/POZ domain. This domain mediates protein-protein interactions. A mutation in this gene may be associated with bipolar disorder. [provided by RefSeq, Sep 2016]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acad11 T G 9: 104,086,023 probably benign Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lilra6 T C 7: 3,911,454 Y566C probably damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Olfr301 T C 7: 86,413,082 V281A possibly damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Btbd16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Btbd16 APN 7 130788822 missense probably damaging 1.00
IGL01020:Btbd16 APN 7 130824361 missense probably damaging 1.00
IGL01098:Btbd16 APN 7 130823245 missense probably damaging 1.00
IGL01412:Btbd16 APN 7 130805819 critical splice acceptor site probably null
1mM(1):Btbd16 UTSW 7 130821491 missense possibly damaging 0.86
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0063:Btbd16 UTSW 7 130823166 missense probably benign 0.25
R0147:Btbd16 UTSW 7 130779594 missense probably damaging 1.00
R0436:Btbd16 UTSW 7 130786053 missense probably benign 0.10
R0715:Btbd16 UTSW 7 130788827 missense probably damaging 1.00
R2127:Btbd16 UTSW 7 130784308 missense probably benign 0.17
R3798:Btbd16 UTSW 7 130777140 missense probably benign 0.43
R5595:Btbd16 UTSW 7 130823303 missense possibly damaging 0.52
R5595:Btbd16 UTSW 7 130823304 missense probably damaging 1.00
R5839:Btbd16 UTSW 7 130815808 critical splice donor site probably null
R5933:Btbd16 UTSW 7 130784281 missense probably damaging 0.99
R6029:Btbd16 UTSW 7 130819072 missense probably benign 0.17
R7255:Btbd16 UTSW 7 130785992 missense probably benign 0.04
R7355:Btbd16 UTSW 7 130821443 missense probably benign 0.01
R7405:Btbd16 UTSW 7 130805856 missense probably benign 0.08
R7527:Btbd16 UTSW 7 130820472 missense probably damaging 1.00
X0064:Btbd16 UTSW 7 130823170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGATCAGCTTTCCTTGCC -3'
(R):5'- CTCTAAGTCAGGTTTGGGACAG -3'

Sequencing Primer
(F):5'- CTTCTTCAGCAAGCTGTGGG -3'
(R):5'- CTAAGTCAGGTTTGGGACAGAGGAAC -3'
Posted On2014-11-12