Incidental Mutation 'R2411:Nsf'
ID250004
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 040376-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2411 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103930752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 93.9%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4933402D24Rik A G 1: 63,756,214 probably benign Het
9030612E09Rik G T 10: 43,174,800 R30L possibly damaging Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Aadacl2 A G 3: 60,017,423 D137G possibly damaging Het
Acad11 T G 9: 104,086,023 probably benign Het
Acap1 A T 11: 69,885,485 N229K probably damaging Het
Agbl1 A G 7: 76,720,150 T666A probably damaging Het
Btbd16 T C 7: 130,790,224 F160L probably damaging Het
Clock A C 5: 76,231,513 H525Q probably benign Het
Col6a1 G T 10: 76,711,088 Q767K unknown Het
Creld1 A G 6: 113,489,776 H240R probably benign Het
Dlg4 G A 11: 70,041,929 probably null Het
Fam204a A T 19: 60,199,438 *237R probably null Het
Filip1 T A 9: 79,898,433 N13I probably damaging Het
Gm14295 G T 2: 176,807,413 A19S probably benign Het
Hddc3 A T 7: 80,343,593 Q56L probably damaging Het
Hes6 A C 1: 91,413,264 probably null Het
Hormad1 A G 3: 95,580,015 D270G probably benign Het
Ifitm1 A G 7: 140,969,798 probably null Het
Igbp1b A C 6: 138,657,873 V191G probably damaging Het
Impg2 T A 16: 56,252,154 N316K probably damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Lilra6 T C 7: 3,911,454 Y566C probably damaging Het
Map4k4 A G 1: 40,007,496 D775G probably damaging Het
Mtmr10 A T 7: 64,297,497 K53N probably damaging Het
Mybpc2 G A 7: 44,506,238 R864W probably damaging Het
Nckap1l C A 15: 103,483,568 P810Q probably damaging Het
Olfr1197 C T 2: 88,729,397 M67I probably benign Het
Olfr1377 A G 11: 50,984,931 T77A probably damaging Het
Olfr301 T C 7: 86,413,082 V281A possibly damaging Het
Ppp2r3c T C 12: 55,298,484 K73R probably benign Het
Ptpru A T 4: 131,771,469 F1311Y probably damaging Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Setd2 A G 9: 110,550,429 E1104G possibly damaging Het
St14 G A 9: 31,108,234 T97I probably benign Het
Stag3 A G 5: 138,283,028 probably benign Het
Sytl3 T C 17: 6,736,493 S326P probably damaging Het
Tor1b G T 2: 30,955,812 S167I probably damaging Het
Ttn T A 2: 76,738,015 E27511D probably damaging Het
Uso1 T A 5: 92,158,399 probably benign Het
Vmn1r10 G T 6: 57,114,139 V239F probably benign Het
Zfp160 C T 17: 21,025,745 R186C possibly damaging Het
Zfp869 A G 8: 69,706,529 C465R probably damaging Het
Zfp957 T C 14: 79,214,342 K6E unknown Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTTTGACAGTGTAATGACAG -3'
(R):5'- CTACCCTGGAGGAAGAAACACG -3'

Sequencing Primer
(F):5'- GTTTGACAGTGTAATGACAGAAATGC -3'
(R):5'- TCAGGATGGAGGGACATTTACTAC -3'
Posted On2014-11-12