Incidental Mutation 'R2412:Olfr1097'
ID250021
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2412 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86890834 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 114 (I114V)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect probably benign
Transcript: ENSMUST00000111576
AA Change: I114V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: I114V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217403
AA Change: I114V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,073,591 Q114L probably benign Het
Adamts3 A G 5: 89,701,771 Y597H probably damaging Het
Bmi1 A G 2: 18,683,714 H172R probably damaging Het
Cyp3a44 A T 5: 145,779,579 Y400* probably null Het
Dennd5b T C 6: 149,005,238 T1062A possibly damaging Het
Dync2h1 T C 9: 7,144,246 D1065G probably benign Het
Ephb1 G A 9: 102,001,816 R492C possibly damaging Het
Fat4 A T 3: 38,957,072 H2107L probably benign Het
Gm10436 A G 12: 88,177,110 V311A probably damaging Het
Itga8 A G 2: 12,301,715 V23A probably benign Het
Lrba A G 3: 86,327,700 N851D probably damaging Het
Ltbp3 A G 19: 5,746,645 T322A probably benign Het
Ntpcr T C 8: 125,745,405 V151A probably damaging Het
Olfr1012 C A 2: 85,759,680 G232V probably damaging Het
Rps6ka4 A T 19: 6,829,941 *774K probably null Het
Slc12a5 T C 2: 164,976,462 probably null Het
Tmem219 T C 7: 126,896,767 S37G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,457,110 N195S possibly damaging Het
Zan A G 5: 137,414,163 probably null Het
Zfp85 T C 13: 67,749,646 I102M probably damaging Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0042:Olfr1097 UTSW 2 86890491 missense probably damaging 1.00
R0605:Olfr1097 UTSW 2 86890419 missense possibly damaging 0.65
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R4465:Olfr1097 UTSW 2 86891150 missense probably benign
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R5847:Olfr1097 UTSW 2 86890332 missense probably damaging 0.99
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7256:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGTTGCAGAAATCCAGTGTGC -3'
(R):5'- ACTGTCTTGGGAAACATAGGTATG -3'

Sequencing Primer
(F):5'- TGCAGAAATCCAGTGTGCTTAAGC -3'
(R):5'- ACTGATCATTCATCTAGATGTCCAGC -3'
Posted On2014-11-12