Incidental Mutation 'R2412:Tubb1'
ID250023
Institutional Source Beutler Lab
Gene Symbol Tubb1
Ensembl Gene ENSMUSG00000016255
Gene Nametubulin, beta 1 class VI
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2412 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location174450695-174457882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174457110 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 195 (N195S)
Ref Sequence ENSEMBL: ENSMUSP00000016399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016396] [ENSMUST00000016399]
Predicted Effect probably benign
Transcript: ENSMUST00000016396
SMART Domains Protein: ENSMUSP00000016396
Gene: ENSMUSG00000016252

DomainStartEndE-ValueType
Pfam:ATP-synt_Eps 2 51 7.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000016399
AA Change: N195S

PolyPhen 2 Score 0.709 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000016399
Gene: ENSMUSG00000016255
AA Change: N195S

DomainStartEndE-ValueType
Tubulin 47 244 3.42e-68 SMART
Tubulin_C 246 383 1.84e-41 SMART
low complexity region 433 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149191
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes have thrombocytopenia resulting from a defect in generating proplatelets. The platelets that are produced have structural and functional defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,073,591 Q114L probably benign Het
Adamts3 A G 5: 89,701,771 Y597H probably damaging Het
Bmi1 A G 2: 18,683,714 H172R probably damaging Het
Cyp3a44 A T 5: 145,779,579 Y400* probably null Het
Dennd5b T C 6: 149,005,238 T1062A possibly damaging Het
Dync2h1 T C 9: 7,144,246 D1065G probably benign Het
Ephb1 G A 9: 102,001,816 R492C possibly damaging Het
Fat4 A T 3: 38,957,072 H2107L probably benign Het
Gm10436 A G 12: 88,177,110 V311A probably damaging Het
Itga8 A G 2: 12,301,715 V23A probably benign Het
Lrba A G 3: 86,327,700 N851D probably damaging Het
Ltbp3 A G 19: 5,746,645 T322A probably benign Het
Ntpcr T C 8: 125,745,405 V151A probably damaging Het
Olfr1012 C A 2: 85,759,680 G232V probably damaging Het
Olfr1097 T C 2: 86,890,834 I114V probably benign Het
Rps6ka4 A T 19: 6,829,941 *774K probably null Het
Slc12a5 T C 2: 164,976,462 probably null Het
Tmem219 T C 7: 126,896,767 S37G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Zan A G 5: 137,414,163 probably null Het
Zfp85 T C 13: 67,749,646 I102M probably damaging Het
Other mutations in Tubb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Tubb1 APN 2 174456898 missense possibly damaging 0.87
IGL02534:Tubb1 APN 2 174455669 missense probably benign 0.04
IGL02535:Tubb1 APN 2 174457566 missense probably benign 0.00
IGL03404:Tubb1 APN 2 174457448 missense probably damaging 1.00
R0117:Tubb1 UTSW 2 174457784 missense probably benign 0.00
R0666:Tubb1 UTSW 2 174457755 missense probably damaging 0.98
R0939:Tubb1 UTSW 2 174455756 missense probably damaging 1.00
R1163:Tubb1 UTSW 2 174457739 missense probably benign
R1317:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1458:Tubb1 UTSW 2 174450803 critical splice donor site probably null
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1658:Tubb1 UTSW 2 174456623 missense probably damaging 1.00
R1751:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1761:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1869:Tubb1 UTSW 2 174456689 missense probably benign 0.00
R1969:Tubb1 UTSW 2 174455691 missense possibly damaging 0.92
R4249:Tubb1 UTSW 2 174455733 missense probably null 0.93
R4415:Tubb1 UTSW 2 174457673 missense probably benign 0.12
R5154:Tubb1 UTSW 2 174456864 missense probably benign 0.19
R5276:Tubb1 UTSW 2 174457424 missense probably damaging 0.97
R5730:Tubb1 UTSW 2 174457769 missense probably benign
R6008:Tubb1 UTSW 2 174457774 missense probably benign 0.00
R6719:Tubb1 UTSW 2 174457394 missense probably damaging 1.00
R7422:Tubb1 UTSW 2 174457032 missense possibly damaging 0.76
X0063:Tubb1 UTSW 2 174457295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAGCTGATCGAAAATGTCATG -3'
(R):5'- CATATTCACGGCCAGCTTGC -3'

Sequencing Primer
(F):5'- CCTACAGGGTTTCCAGATCGTG -3'
(R):5'- CAGCTTGCGCAGGTCTG -3'
Posted On2014-11-12