Incidental Mutation 'R2412:Ntpcr'
ID250037
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2412 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125745405 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 151 (V151A)
Ref Sequence ENSEMBL: ENSMUSP00000115996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000143504] [ENSMUST00000152189]
Predicted Effect probably damaging
Transcript: ENSMUST00000034313
AA Change: V155A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851
AA Change: V155A

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138656
Predicted Effect probably damaging
Transcript: ENSMUST00000143504
AA Change: V118A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851
AA Change: V118A

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146055
Predicted Effect probably damaging
Transcript: ENSMUST00000152189
AA Change: V151A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851
AA Change: V151A

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,073,591 Q114L probably benign Het
Adamts3 A G 5: 89,701,771 Y597H probably damaging Het
Bmi1 A G 2: 18,683,714 H172R probably damaging Het
Cyp3a44 A T 5: 145,779,579 Y400* probably null Het
Dennd5b T C 6: 149,005,238 T1062A possibly damaging Het
Dync2h1 T C 9: 7,144,246 D1065G probably benign Het
Ephb1 G A 9: 102,001,816 R492C possibly damaging Het
Fat4 A T 3: 38,957,072 H2107L probably benign Het
Gm10436 A G 12: 88,177,110 V311A probably damaging Het
Itga8 A G 2: 12,301,715 V23A probably benign Het
Lrba A G 3: 86,327,700 N851D probably damaging Het
Ltbp3 A G 19: 5,746,645 T322A probably benign Het
Olfr1012 C A 2: 85,759,680 G232V probably damaging Het
Olfr1097 T C 2: 86,890,834 I114V probably benign Het
Rps6ka4 A T 19: 6,829,941 *774K probably null Het
Slc12a5 T C 2: 164,976,462 probably null Het
Tmem219 T C 7: 126,896,767 S37G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,457,110 N195S possibly damaging Het
Zan A G 5: 137,414,163 probably null Het
Zfp85 T C 13: 67,749,646 I102M probably damaging Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R0988:Ntpcr UTSW 8 125737431 splice site probably benign
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R3838:Ntpcr UTSW 8 125737372 missense probably damaging 1.00
R4453:Ntpcr UTSW 8 125736190 missense probably benign 0.14
R6126:Ntpcr UTSW 8 125735887 critical splice donor site probably null
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
R8230:Ntpcr UTSW 8 125737420 critical splice donor site probably null
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCTTCTTGTCCACAGGCAGG -3'
(R):5'- GCCACTGAATACATGACCTAAGG -3'

Sequencing Primer
(F):5'- ACAGGCAGGCTCCAGCTG -3'
(R):5'- TGAATACATGACCTAAGGCTCCTGTC -3'
Posted On2014-11-12