Incidental Mutation 'R2412:Gm10436'
ID250041
Institutional Source Beutler Lab
Gene Symbol Gm10436
Ensembl Gene ENSMUSG00000066027
Gene Namepredicted gene 10436
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R2412 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location88175589-88182108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88177110 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 311 (V311A)
Ref Sequence ENSEMBL: ENSMUSP00000152194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071580] [ENSMUST00000220521] [ENSMUST00000222081] [ENSMUST00000223172]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071580
AA Change: V319A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071508
Gene: ENSMUSG00000066027
AA Change: V319A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 247 445 5e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220521
AA Change: V124A

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000221884
Predicted Effect probably damaging
Transcript: ENSMUST00000222081
AA Change: V311A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000222391
Predicted Effect probably benign
Transcript: ENSMUST00000222556
Predicted Effect probably benign
Transcript: ENSMUST00000223172
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 A T 3: 36,073,591 Q114L probably benign Het
Adamts3 A G 5: 89,701,771 Y597H probably damaging Het
Bmi1 A G 2: 18,683,714 H172R probably damaging Het
Cyp3a44 A T 5: 145,779,579 Y400* probably null Het
Dennd5b T C 6: 149,005,238 T1062A possibly damaging Het
Dync2h1 T C 9: 7,144,246 D1065G probably benign Het
Ephb1 G A 9: 102,001,816 R492C possibly damaging Het
Fat4 A T 3: 38,957,072 H2107L probably benign Het
Itga8 A G 2: 12,301,715 V23A probably benign Het
Lrba A G 3: 86,327,700 N851D probably damaging Het
Ltbp3 A G 19: 5,746,645 T322A probably benign Het
Ntpcr T C 8: 125,745,405 V151A probably damaging Het
Olfr1012 C A 2: 85,759,680 G232V probably damaging Het
Olfr1097 T C 2: 86,890,834 I114V probably benign Het
Rps6ka4 A T 19: 6,829,941 *774K probably null Het
Slc12a5 T C 2: 164,976,462 probably null Het
Tmem219 T C 7: 126,896,767 S37G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,457,110 N195S possibly damaging Het
Zan A G 5: 137,414,163 probably null Het
Zfp85 T C 13: 67,749,646 I102M probably damaging Het
Other mutations in Gm10436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Gm10436 APN 12 88177112 missense probably benign 0.35
IGL01391:Gm10436 APN 12 88178455 missense possibly damaging 0.84
IGL01432:Gm10436 APN 12 88176432 missense probably benign 0.44
IGL01519:Gm10436 APN 12 88177561 missense probably benign 0.00
IGL01784:Gm10436 APN 12 88176315 missense probably benign
IGL02121:Gm10436 APN 12 88178472 missense possibly damaging 0.83
IGL02728:Gm10436 APN 12 88176022 missense probably benign 0.17
R0336:Gm10436 UTSW 12 88178191 missense probably benign 0.20
R0554:Gm10436 UTSW 12 88177558 missense probably benign 0.10
R1279:Gm10436 UTSW 12 88175880 missense probably benign 0.42
R1832:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1833:Gm10436 UTSW 12 88178448 missense possibly damaging 0.73
R1900:Gm10436 UTSW 12 88177260 missense probably benign 0.02
R3040:Gm10436 UTSW 12 88178348 missense probably benign 0.00
R3625:Gm10436 UTSW 12 88175961 missense probably benign 0.06
R4078:Gm10436 UTSW 12 88175913 missense probably benign 0.38
R4270:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R4271:Gm10436 UTSW 12 88178283 missense probably damaging 1.00
R5318:Gm10436 UTSW 12 88176228 missense probably benign 0.01
R5552:Gm10436 UTSW 12 88178365 missense probably benign 0.03
R5601:Gm10436 UTSW 12 88176047 missense probably damaging 1.00
R5881:Gm10436 UTSW 12 88176341 missense probably damaging 1.00
R5973:Gm10436 UTSW 12 88175913 missense probably benign 0.02
R6058:Gm10436 UTSW 12 88177225 missense possibly damaging 0.91
R6488:Gm10436 UTSW 12 88177587 missense possibly damaging 0.87
R6656:Gm10436 UTSW 12 88175993 missense possibly damaging 0.89
R7307:Gm10436 UTSW 12 88181749 missense probably damaging 1.00
R7332:Gm10436 UTSW 12 88176417 missense possibly damaging 0.72
R7544:Gm10436 UTSW 12 88176080 missense probably benign 0.00
R7569:Gm10436 UTSW 12 88176315 missense probably benign
R7645:Gm10436 UTSW 12 88176258 missense probably damaging 1.00
R7752:Gm10436 UTSW 12 88175999 missense probably damaging 1.00
R7855:Gm10436 UTSW 12 88176083 missense probably benign 0.03
R7860:Gm10436 UTSW 12 88176352 missense possibly damaging 0.89
R8113:Gm10436 UTSW 12 88177080 missense probably benign 0.00
R8356:Gm10436 UTSW 12 88177216 missense probably benign 0.01
R8456:Gm10436 UTSW 12 88177216 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCCTCATCATACATATCTTAGCAC -3'
(R):5'- AGAAGAGTTGGCTTTTCTTAATCCC -3'

Sequencing Primer
(F):5'- GCACACAGCTCATCTACTCAGATATG -3'
(R):5'- TCTTAATCCCTACCTGAAACTGATG -3'
Posted On2014-11-12