Mutagenetix > Incidental Mutations

Incidental Mutation 'R2412:Ltbp3'

250044

Institutional Source

Beutler Lab

Gene Symbol

Ltbp3

Ensembl Gene

ENSMUSG00000024940

Gene Name

latent transforming growth factor beta binding protein 3

Synonyms

Ltbp2

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.276) question?

Stock #

R2412 (G1)

Quality Score

194

Status

Not validated

Chromosome

Chromosomal Location

5740904-5758532 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 5746645 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 322 (T322A)

Ref Sequence

ENSEMBL: ENSMUSP00000080214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081496]

Predicted Effect

probably benign
Transcript: ENSMUST00000081496
AA Change: T322A

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940
AA Change: T322A

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
EGF	109	138	6.76e-3	SMART
low complexity region	140	154	N/A	INTRINSIC
low complexity region	191	199	N/A	INTRINSIC
low complexity region	221	233	N/A	INTRINSIC
low complexity region	254	273	N/A	INTRINSIC
Pfam:TB	286	323	8e-9	PFAM
EGF_CA	352	392	2.08e-12	SMART
Pfam:TB	411	451	4.8e-18	PFAM
low complexity region	526	537	N/A	INTRINSIC
EGF_CA	571	612	8.71e-6	SMART
EGF_CA	613	656	2.8e-9	SMART
EGF_CA	657	699	2.48e-10	SMART
EGF_CA	700	740	4.96e-10	SMART
EGF_CA	741	781	1.69e-12	SMART
EGF_CA	782	822	1.94e-12	SMART
EGF_CA	823	862	3.27e-10	SMART
EGF_CA	863	905	3.32e-11	SMART
Pfam:TB	925	967	5.7e-16	PFAM
EGF_CA	990	1032	4.49e-8	SMART
EGF_CA	1033	1073	3.17e-8	SMART
Pfam:TB	1097	1134	1.2e-11	PFAM
EGF	1170	1203	1.53e1	SMART
EGF_CA	1204	1248	1.53e-10	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with transforming growth factor beta (TGF-beta) proteins and may be involved in their subcellular localization. Activation of this complex requires removal of the encoded binding protein. This protein also may play a structural role in the extracellular matrix. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit craniofacial malformations including an overshot mandible and ossification of synchondroses. Mutants develop osteosclerosis of long bones and osteoarthritis, and, in some cases, high corticosterone levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acad9	A	T	3: 36,073,591	Q114L	probably benign	Het
Adamts3	A	G	5: 89,701,771	Y597H	probably damaging	Het
Bmi1	A	G	2: 18,683,714	H172R	probably damaging	Het
Cyp3a44	A	T	5: 145,779,579	Y400*	probably null	Het
Dennd5b	T	C	6: 149,005,238	T1062A	possibly damaging	Het
Dync2h1	T	C	9: 7,144,246	D1065G	probably benign	Het
Ephb1	G	A	9: 102,001,816	R492C	possibly damaging	Het
Fat4	A	T	3: 38,957,072	H2107L	probably benign	Het
Gm10436	A	G	12: 88,177,110	V311A	probably damaging	Het
Itga8	A	G	2: 12,301,715	V23A	probably benign	Het
Lrba	A	G	3: 86,327,700	N851D	probably damaging	Het
Ntpcr	T	C	8: 125,745,405	V151A	probably damaging	Het
Olfr1012	C	A	2: 85,759,680	G232V	probably damaging	Het
Olfr1097	T	C	2: 86,890,834	I114V	probably benign	Het
Rps6ka4	A	T	19: 6,829,941	*774K	probably null	Het
Slc12a5	T	C	2: 164,976,462		probably null	Het
Tmem219	T	C	7: 126,896,767	S37G	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Tubb1	A	G	2: 174,457,110	N195S	possibly damaging	Het
Zan	A	G	5: 137,414,163		probably null	Het
Zfp85	T	C	13: 67,749,646	I102M	probably damaging	Het

Other mutations in Ltbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Ltbp3	APN	19	5756016	missense	probably damaging	0.99
IGL00978:Ltbp3	APN	19	5754019	missense	probably benign	0.26
IGL01517:Ltbp3	APN	19	5757732	missense	possibly damaging	0.57
IGL01529:Ltbp3	APN	19	5747839	missense	probably benign	0.06
IGL03119:Ltbp3	APN	19	5757443	missense	probably damaging	0.98
csp	UTSW	19	5747688	missense	probably damaging	1.00
lilia	UTSW	19	5747857	critical splice donor site	probably null
Rapunzel	UTSW	19	5753942	nonsense	probably null
PIT4305001:Ltbp3	UTSW	19	5752067	missense	probably damaging	0.99
PIT4453001:Ltbp3	UTSW	19	5757794	missense	probably damaging	0.97
PIT4480001:Ltbp3	UTSW	19	5751226	missense	possibly damaging	0.73
R0211:Ltbp3	UTSW	19	5752143	critical splice donor site	probably null
R0718:Ltbp3	UTSW	19	5746748	splice site	probably benign
R1103:Ltbp3	UTSW	19	5747411	critical splice acceptor site	probably null
R1103:Ltbp3	UTSW	19	5747412	critical splice acceptor site	probably null
R1299:Ltbp3	UTSW	19	5745428	splice site	probably benign
R1510:Ltbp3	UTSW	19	5748887	missense	probably benign	0.02
R1616:Ltbp3	UTSW	19	5746967	missense	probably damaging	1.00
R1682:Ltbp3	UTSW	19	5751754	missense	probably benign	0.02
R1752:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R1806:Ltbp3	UTSW	19	5753942	nonsense	probably null
R1866:Ltbp3	UTSW	19	5747849	missense	probably benign	0.43
R1981:Ltbp3	UTSW	19	5758079	missense	probably benign	0.15
R2211:Ltbp3	UTSW	19	5753962	missense	possibly damaging	0.79
R2239:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2261:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2263:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2380:Ltbp3	UTSW	19	5751523	nonsense	probably null
R2446:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R2449:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3056:Ltbp3	UTSW	19	5751406	missense	probably benign	0.11
R3080:Ltbp3	UTSW	19	5756888	frame shift	probably null
R3863:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3864:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3951:Ltbp3	UTSW	19	5756001	missense	probably damaging	1.00
R3961:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3962:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3963:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R3972:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4028:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4031:Ltbp3	UTSW	19	5754022	missense	probably benign	0.02
R4041:Ltbp3	UTSW	19	5751871	missense	possibly damaging	0.95
R4060:Ltbp3	UTSW	19	5742320	missense	probably benign	0.41
R4296:Ltbp3	UTSW	19	5756582	critical splice acceptor site	probably null
R4525:Ltbp3	UTSW	19	5746359	missense	probably benign	0.09
R4660:Ltbp3	UTSW	19	5748786	splice site	probably null
R4794:Ltbp3	UTSW	19	5756679	missense	probably damaging	1.00
R4980:Ltbp3	UTSW	19	5753927	critical splice acceptor site	probably null
R5071:Ltbp3	UTSW	19	5756823	missense	probably damaging	1.00
R5702:Ltbp3	UTSW	19	5747821	missense	probably benign
R5771:Ltbp3	UTSW	19	5747544	missense	probably damaging	1.00
R6021:Ltbp3	UTSW	19	5753680	missense	probably benign	0.00
R6053:Ltbp3	UTSW	19	5752094	missense	probably damaging	0.98
R6321:Ltbp3	UTSW	19	5745657	missense	probably benign	0.09
R6339:Ltbp3	UTSW	19	5747477	missense	probably damaging	1.00
R6371:Ltbp3	UTSW	19	5745772	splice site	probably null
R6709:Ltbp3	UTSW	19	5747857	critical splice donor site	probably null
R7666:Ltbp3	UTSW	19	5747006	missense	possibly damaging	0.79
R8499:Ltbp3	UTSW	19	5748684	missense	probably benign	0.01
X0066:Ltbp3	UTSW	19	5751277	missense	probably benign	0.01
Z1177:Ltbp3	UTSW	19	5747730	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGCTGTGGGAATTTCACC -3'
(R):5'- CATAGCTGGGGCCATAACATG -3'

Sequencing Primer
(F):5'- GGGAATTTCACCCCACCC -3'
(R):5'- ACACACTTGAGGGTTCTGC -3'

Posted On

2014-11-12