Incidental Mutation 'R2413:Fam43b'
ID250056
Institutional Source Beutler Lab
Gene Symbol Fam43b
Ensembl Gene ENSMUSG00000078235
Gene Namefamily with sequence similarity 43, member B
SynonymsOTTMUSG00000009974
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R2413 (G1)
Quality Score97
Status Not validated
Chromosome4
Chromosomal Location138394092-138396528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 138395098 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 304 (R304G)
Ref Sequence ENSEMBL: ENSMUSP00000100649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105032]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062902
Predicted Effect probably benign
Transcript: ENSMUST00000105032
AA Change: R304G

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100649
Gene: ENSMUSG00000078235
AA Change: R304G

DomainStartEndE-ValueType
Pfam:PID_2 71 265 3.4e-75 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Fam43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2128:Fam43b UTSW 4 138395988 missense possibly damaging 0.87
R2258:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2281:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2416:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2417:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3705:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3715:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3797:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3798:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3854:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3856:Fam43b UTSW 4 138395098 missense probably benign 0.25
R4639:Fam43b UTSW 4 138395967 missense possibly damaging 0.66
R4868:Fam43b UTSW 4 138395797 missense probably benign 0.32
R5129:Fam43b UTSW 4 138395472 nonsense probably null
R6176:Fam43b UTSW 4 138395211 missense probably damaging 0.99
R7296:Fam43b UTSW 4 138395841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATTACAGTGACCGCGAG -3'
(R):5'- AGTCTTCACCTGGGTCTACC -3'

Sequencing Primer
(F):5'- TGCAGGCCAGGGACCAG -3'
(R):5'- TTCAGCGACTTCAAGCGG -3'
Posted On2014-11-12