Incidental Mutation 'R2413:Tex52'
ID250060
Institutional Source Beutler Lab
Gene Symbol Tex52
Ensembl Gene ENSMUSG00000079304
Gene Nametestis expressed 52
Synonyms4933413G19Rik
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128375456-128385144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128379908 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 188 (L188P)
Ref Sequence ENSEMBL: ENSMUSP00000145112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073316] [ENSMUST00000100926] [ENSMUST00000130785] [ENSMUST00000204223]
Predicted Effect probably benign
Transcript: ENSMUST00000073316
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100926
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098486
Gene: ENSMUSG00000079304
AA Change: L188P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 306 1.9e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130785
AA Change: L188P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145112
Gene: ENSMUSG00000079304
AA Change: L188P

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:DUF4532 28 223 3.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203779
Predicted Effect probably benign
Transcript: ENSMUST00000204223
SMART Domains Protein: ENSMUSP00000145012
Gene: ENSMUSG00000108011

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Tex52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02528:Tex52 APN 6 128379497 missense possibly damaging 0.60
IGL03304:Tex52 APN 6 128379532 missense possibly damaging 0.55
R0384:Tex52 UTSW 6 128379533 missense probably damaging 1.00
R0462:Tex52 UTSW 6 128384954 missense probably benign
R2398:Tex52 UTSW 6 128379577 missense probably damaging 1.00
R4856:Tex52 UTSW 6 128384988 unclassified probably null
R5230:Tex52 UTSW 6 128384816 missense probably damaging 1.00
R5666:Tex52 UTSW 6 128375555 missense probably benign 0.01
R5864:Tex52 UTSW 6 128379682 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CATTTGACTCACGCCAATGC -3'
(R):5'- ATGGGTTCCTGCCATACAAAAG -3'

Sequencing Primer
(F):5'- GCCAATGCCCACCGTCTC -3'
(R):5'- CACAGGTAGCCACGAGTG -3'
Posted On2014-11-12