Incidental Mutation 'R2413:Olfr578'
ID250064
Institutional Source Beutler Lab
Gene Symbol Olfr578
Ensembl Gene ENSMUSG00000045792
Gene Nameolfactory receptor 578
SynonymsMOR7-1, GA_x6K02T2PBJ9-5696486-5695545
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102981608-102989324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102984802 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000149209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056235] [ENSMUST00000215606]
Predicted Effect probably damaging
Transcript: ENSMUST00000056235
AA Change: S121P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058167
Gene: ENSMUSG00000045792
AA Change: S121P

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.6e-7 PFAM
Pfam:7tm_1 43 294 3.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215606
AA Change: S121P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Olfr578
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Olfr578 APN 7 102984702 missense probably damaging 0.97
IGL02658:Olfr578 APN 7 102984330 missense probably benign 0.00
R0833:Olfr578 UTSW 7 102984836 missense possibly damaging 0.50
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R1470:Olfr578 UTSW 7 102984323 nonsense probably null
R2029:Olfr578 UTSW 7 102984271 missense probably damaging 0.99
R2249:Olfr578 UTSW 7 102984440 missense possibly damaging 0.74
R2898:Olfr578 UTSW 7 102984877 missense probably benign 0.19
R4441:Olfr578 UTSW 7 102984309 missense possibly damaging 0.65
R5696:Olfr578 UTSW 7 102984541 missense probably benign 0.02
R6810:Olfr578 UTSW 7 102984835 missense probably damaging 1.00
R7263:Olfr578 UTSW 7 102984317 nonsense probably null
R7366:Olfr578 UTSW 7 102984516 missense probably damaging 1.00
X0022:Olfr578 UTSW 7 102985026 missense probably benign 0.02
X0028:Olfr578 UTSW 7 102984343 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGCTAACACGTGGGATC -3'
(R):5'- AGGAAACCTCACTATTCTCCATGTC -3'

Sequencing Primer
(F):5'- CTAACACGTGGGATCGGCAATAATG -3'
(R):5'- GGACTGATGCCACTCTCCATG -3'
Posted On2014-11-12