Incidental Mutation 'R2413:Adcy7'
ID250065
Institutional Source Beutler Lab
Gene Symbol Adcy7
Ensembl Gene ENSMUSG00000031659
Gene Nameadenylate cyclase 7
Synonyms
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88272403-88329962 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88309818 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 168 (A168S)
Ref Sequence ENSEMBL: ENSMUSP00000132528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098521] [ENSMUST00000168545] [ENSMUST00000169037] [ENSMUST00000171456]
Predicted Effect probably benign
Transcript: ENSMUST00000098521
AA Change: A168S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096122
Gene: ENSMUSG00000031659
AA Change: A168S

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168545
AA Change: A168S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129252
Gene: ENSMUSG00000031659
AA Change: A168S

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169037
AA Change: A168S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130594
Gene: ENSMUSG00000031659
AA Change: A168S

DomainStartEndE-ValueType
transmembrane domain 34 53 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 179 198 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 8.8e-27 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171456
AA Change: A168S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132528
Gene: ENSMUSG00000031659
AA Change: A168S

DomainStartEndE-ValueType
low complexity region 91 104 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
CYCc 226 434 2.99e-64 SMART
low complexity region 457 473 N/A INTRINSIC
Pfam:DUF1053 487 594 1.2e-35 PFAM
transmembrane domain 620 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
transmembrane domain 719 741 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
transmembrane domain 816 833 N/A INTRINSIC
low complexity region 847 858 N/A INTRINSIC
CYCc 859 1071 1.54e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211311
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound adenylate cyclase that catalyses the formation of cyclic AMP from ATP and is inhibitable by calcium. The product of this gene is a member of the adenylyl cyclase class-4/guanylyl cyclase enzyme family that is characterized by the presence of twelve membrane-spanning domains in its sequences. Several transcript variants have been observed for this gene, but the full-length natures of only two have been determined so far. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display some degree of pre- or postnatal lethality. Surviving adults for one allele appear to be normal. Heterozygous females for one allele display decreased depression related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Adcy7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Adcy7 APN 8 88318790 splice site probably benign
IGL01434:Adcy7 APN 8 88324844 missense probably damaging 1.00
IGL01784:Adcy7 APN 8 88314123 missense probably damaging 1.00
IGL02506:Adcy7 APN 8 88317943 missense probably damaging 1.00
IGL03184:Adcy7 APN 8 88308643 missense probably benign 0.00
IGL03406:Adcy7 APN 8 88318319 nonsense probably null
Churchill UTSW 8 88315759 missense probably damaging 1.00
democracy UTSW 8 88315756 missense probably damaging 1.00
Dictatorship UTSW 8 88311108 missense possibly damaging 0.80
periphery UTSW 8 88317937 missense probably benign 0.01
republic UTSW 8 88314137 missense probably damaging 1.00
tyranny UTSW 8 88312228 missense possibly damaging 0.76
PIT4283001:Adcy7 UTSW 8 88315492 missense probably damaging 1.00
PIT4453001:Adcy7 UTSW 8 88323636 missense probably benign 0.07
R0265:Adcy7 UTSW 8 88324763 missense probably damaging 0.96
R0963:Adcy7 UTSW 8 88312265 missense probably damaging 1.00
R0990:Adcy7 UTSW 8 88325452 missense possibly damaging 0.57
R1055:Adcy7 UTSW 8 88318057 splice site probably benign
R1494:Adcy7 UTSW 8 88320207 missense probably benign 0.00
R1764:Adcy7 UTSW 8 88308840 missense probably benign 0.00
R2062:Adcy7 UTSW 8 88312274 missense probably damaging 1.00
R2090:Adcy7 UTSW 8 88315857 missense probably damaging 0.98
R2201:Adcy7 UTSW 8 88317978 missense probably damaging 1.00
R2849:Adcy7 UTSW 8 88327393 missense probably benign 0.38
R4020:Adcy7 UTSW 8 88308734 missense probably benign 0.00
R4086:Adcy7 UTSW 8 88315786 missense probably benign 0.01
R4679:Adcy7 UTSW 8 88317937 missense probably benign 0.01
R5069:Adcy7 UTSW 8 88327697 missense probably damaging 1.00
R5253:Adcy7 UTSW 8 88314114 missense probably damaging 1.00
R5286:Adcy7 UTSW 8 88324859 missense probably damaging 1.00
R5427:Adcy7 UTSW 8 88326201 critical splice donor site probably null
R5457:Adcy7 UTSW 8 88311021 missense probably damaging 1.00
R5689:Adcy7 UTSW 8 88324784 missense probably benign 0.00
R5907:Adcy7 UTSW 8 88312228 missense possibly damaging 0.76
R5909:Adcy7 UTSW 8 88325496 missense probably damaging 1.00
R5997:Adcy7 UTSW 8 88326392 missense probably benign 0.41
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6038:Adcy7 UTSW 8 88322980 missense probably benign 0.01
R6133:Adcy7 UTSW 8 88325439 missense possibly damaging 0.84
R6190:Adcy7 UTSW 8 88325730 splice site probably null
R6213:Adcy7 UTSW 8 88314137 missense probably damaging 1.00
R6287:Adcy7 UTSW 8 88311108 missense possibly damaging 0.80
R6502:Adcy7 UTSW 8 88325479 missense probably damaging 1.00
R6989:Adcy7 UTSW 8 88308786 missense probably benign
R7042:Adcy7 UTSW 8 88315750 missense probably damaging 0.99
R7829:Adcy7 UTSW 8 88315759 missense probably damaging 1.00
R8067:Adcy7 UTSW 8 88311069 missense probably damaging 1.00
R8113:Adcy7 UTSW 8 88321803 missense probably damaging 1.00
R8118:Adcy7 UTSW 8 88315756 missense probably damaging 1.00
R8190:Adcy7 UTSW 8 88311038 missense possibly damaging 0.49
R8402:Adcy7 UTSW 8 88308735 missense probably benign 0.30
R8421:Adcy7 UTSW 8 88322184 missense probably benign 0.06
R8549:Adcy7 UTSW 8 88326190 missense probably benign
R8827:Adcy7 UTSW 8 88309699 missense possibly damaging 0.73
X0067:Adcy7 UTSW 8 88324600 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACATTCAGATGAGGGTCCTAGG -3'
(R):5'- CAGGATCTCACCACATCAGG -3'

Sequencing Primer
(F):5'- CATTCAGATGAGGGTCCTAGGTCATG -3'
(R):5'- TAGGGCCTGAGTCCACAGAATATC -3'
Posted On2014-11-12