Incidental Mutation 'R2413:Myd88'
ID250067
Institutional Source Beutler Lab
Gene Symbol Myd88
Ensembl Gene ENSMUSG00000032508
Gene Namemyeloid differentiation primary response gene 88
Synonyms
MMRRC Submission 040377-MU
Accession Numbers

VEGA: OTTMUST00000040319; MGI: 108005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119335934-119341411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119337418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 277 (T277A)
Ref Sequence ENSEMBL: ENSMUSP00000035092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035092] [ENSMUST00000039784] [ENSMUST00000139870] [ENSMUST00000170400] [ENSMUST00000175743] [ENSMUST00000176351] [ENSMUST00000176397] [ENSMUST00000177463]
Predicted Effect probably benign
Transcript: ENSMUST00000035092
AA Change: T277A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000035092
Gene: ENSMUSG00000032508
AA Change: T277A

DomainStartEndE-ValueType
DEATH 19 109 7.17e-15 SMART
TIR 160 296 3.39e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039784
SMART Domains Protein: ENSMUSP00000042351
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 38 291 3.6e-88 PFAM
Pfam:Thiolase_C 298 421 3e-53 PFAM
Pfam:ACP_syn_III_C 329 420 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139870
SMART Domains Protein: ENSMUSP00000115746
Gene: ENSMUSG00000032508

DomainStartEndE-ValueType
Pfam:Death 50 109 3.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150837
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175743
SMART Domains Protein: ENSMUSP00000135439
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 291 4.2e-90 PFAM
Pfam:Thiolase_C 298 337 8.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175859
Predicted Effect probably benign
Transcript: ENSMUST00000176351
SMART Domains Protein: ENSMUSP00000134926
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 98 2.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176397
SMART Domains Protein: ENSMUSP00000135191
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 152 4.9e-38 PFAM
Pfam:Thiolase_N 148 246 4.8e-34 PFAM
Pfam:Thiolase_C 214 328 5.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176796
Predicted Effect probably benign
Transcript: ENSMUST00000177463
SMART Domains Protein: ENSMUSP00000135310
Gene: ENSMUSG00000036138

DomainStartEndE-ValueType
Pfam:Thiolase_N 35 199 3.2e-50 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Targeted(9) Gene trapped(4) Chemically induced(5)

Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Myd88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Myd88 APN 9 119337352 unclassified probably benign
Bahia UTSW 9 119338109 intron probably null
Dani_alves UTSW 9 119337823 missense possibly damaging 0.69
lackadaisical UTSW 9 119338692 missense probably damaging 1.00
Myd88rev1 UTSW 9 119337394 missense possibly damaging 0.90
pococurante UTSW 9 119338114 missense probably damaging 1.00
R1695:Myd88 UTSW 9 119337842 intron probably null
R1878:Myd88 UTSW 9 119338620 missense probably benign 0.00
R3417:Myd88 UTSW 9 119337490 missense possibly damaging 0.90
R3836:Myd88 UTSW 9 119338193 unclassified probably benign
R3892:Myd88 UTSW 9 119337816 missense possibly damaging 0.93
R3917:Myd88 UTSW 9 119341398 utr 5 prime probably benign
R4081:Myd88 UTSW 9 119339987 unclassified probably benign
R4634:Myd88 UTSW 9 119338109 intron probably null
R4637:Myd88 UTSW 9 119338109 intron probably null
R5091:Myd88 UTSW 9 119337823 missense possibly damaging 0.69
R5604:Myd88 UTSW 9 119339763 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAGAGATGACATCTGGCTACTG -3'
(R):5'- ACGGACCTGTGTACTTCCTTATG -3'

Sequencing Primer
(F):5'- ACATCTGGCTACTGTAGATGTC -3'
(R):5'- AGTGGATATGTATCATGGATACCTG -3'
Posted On2014-11-12