Incidental Mutation 'R2413:Ipcef1'
ID250068
Institutional Source Beutler Lab
Gene Symbol Ipcef1
Ensembl Gene ENSMUSG00000064065
Gene Nameinteraction protein for cytohesin exchange factors 1
Synonyms
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location6885796-7052478 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6935225 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 92 (P92S)
Ref Sequence ENSEMBL: ENSMUSP00000128131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052751] [ENSMUST00000063036] [ENSMUST00000078070] [ENSMUST00000086896] [ENSMUST00000105601] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000105617] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000145156] [ENSMUST00000170680] [ENSMUST00000147171] [ENSMUST00000144264] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078070
AA Change: P139S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077215
Gene: ENSMUSG00000064065
AA Change: P139S

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 150 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
Blast:PH 286 343 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000086896
AA Change: P92S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084110
Gene: ENSMUSG00000064065
AA Change: P92S

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105617
AA Change: P139S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101242
Gene: ENSMUSG00000064065
AA Change: P139S

DomainStartEndE-ValueType
PH 14 114 5.87e-20 SMART
low complexity region 132 153 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
Blast:PH 282 339 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect possibly damaging
Transcript: ENSMUST00000145156
AA Change: P162S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114267
Gene: ENSMUSG00000064065
AA Change: P162S

DomainStartEndE-ValueType
PH 37 137 5.87e-20 SMART
low complexity region 155 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154998
Predicted Effect probably damaging
Transcript: ENSMUST00000170680
AA Change: P92S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128131
Gene: ENSMUSG00000064065
AA Change: P92S

DomainStartEndE-ValueType
Pfam:PH 3 65 7.4e-8 PFAM
low complexity region 85 106 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144622
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Ipcef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Ipcef1 APN 10 6919968 missense probably damaging 1.00
IGL01018:Ipcef1 APN 10 6890551 missense probably benign
IGL01295:Ipcef1 APN 10 6900642 missense probably damaging 1.00
IGL01738:Ipcef1 APN 10 6890575 missense probably damaging 1.00
IGL03095:Ipcef1 APN 10 6919732 missense probably damaging 1.00
R0001:Ipcef1 UTSW 10 6900600 missense probably damaging 0.99
R0206:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R0208:Ipcef1 UTSW 10 6920062 missense probably damaging 1.00
R1161:Ipcef1 UTSW 10 6980288 critical splice acceptor site probably null
R1496:Ipcef1 UTSW 10 6935173 critical splice donor site probably null
R1592:Ipcef1 UTSW 10 6935182 splice site probably null
R1829:Ipcef1 UTSW 10 6919900 missense probably benign 0.27
R1893:Ipcef1 UTSW 10 6900680 missense probably damaging 1.00
R2107:Ipcef1 UTSW 10 6890501 missense probably benign 0.01
R2160:Ipcef1 UTSW 10 6890650 missense probably damaging 1.00
R2655:Ipcef1 UTSW 10 6979657 missense probably benign 0.02
R2886:Ipcef1 UTSW 10 6900641 missense probably damaging 1.00
R4752:Ipcef1 UTSW 10 6979573 missense probably damaging 1.00
R5134:Ipcef1 UTSW 10 6919950 missense probably benign 0.03
R5800:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R5938:Ipcef1 UTSW 10 6908029 unclassified probably benign
R5989:Ipcef1 UTSW 10 6979532 nonsense probably null
R7397:Ipcef1 UTSW 10 6972244 makesense probably null
R7414:Ipcef1 UTSW 10 6890673 nonsense probably null
R7425:Ipcef1 UTSW 10 6956066 missense probably damaging 1.00
R7859:Ipcef1 UTSW 10 6890569 missense probably damaging 1.00
R7966:Ipcef1 UTSW 10 6900668 missense probably damaging 1.00
R8255:Ipcef1 UTSW 10 6920007 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCACTTGCTCTTTGGGAACC -3'
(R):5'- TAGTGCCATAGGGTTCATGC -3'

Sequencing Primer
(F):5'- GCACTTGCTCTTTGGGAACCTTAAC -3'
(R):5'- GCCATAGGGTTCATGCTTTTTAC -3'
Posted On2014-11-12