Incidental Mutation 'R2413:Serpina9'
ID250071
Institutional Source Beutler Lab
Gene Symbol Serpina9
Ensembl Gene ENSMUSG00000058260
Gene Nameserine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
SynonymsCenterin, 2310014L03Rik
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R2413 (G1)
Quality Score223
Status Not validated
Chromosome12
Chromosomal Location103994743-104013755 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 104001226 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058464]
Predicted Effect probably null
Transcript: ENSMUST00000058464
SMART Domains Protein: ENSMUSP00000058535
Gene: ENSMUSG00000058260

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 55 415 1.27e-158 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176106
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Serpina9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Serpina9 APN 12 104008586 missense probably damaging 1.00
IGL02228:Serpina9 APN 12 104008600 missense probably benign 0.02
IGL02692:Serpina9 APN 12 104008406 missense probably damaging 1.00
IGL03149:Serpina9 APN 12 104008610 nonsense probably null
IGL03134:Serpina9 UTSW 12 104001437 missense probably null 0.18
R0119:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0299:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0499:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R1477:Serpina9 UTSW 12 103997103 missense possibly damaging 0.90
R1912:Serpina9 UTSW 12 104001249 missense probably damaging 1.00
R2142:Serpina9 UTSW 12 104008309 missense probably benign 0.04
R2221:Serpina9 UTSW 12 103998264 missense probably damaging 0.98
R3939:Serpina9 UTSW 12 104008892 start codon destroyed probably benign 0.01
R4515:Serpina9 UTSW 12 104001294 missense probably benign 0.14
R5242:Serpina9 UTSW 12 104008385 missense probably benign 0.09
R5589:Serpina9 UTSW 12 104001469 missense probably benign 0.00
R5900:Serpina9 UTSW 12 104008871 nonsense probably null
R6171:Serpina9 UTSW 12 104008419 nonsense probably null
R6195:Serpina9 UTSW 12 104001407 missense probably damaging 0.96
R6566:Serpina9 UTSW 12 103997037 missense possibly damaging 0.61
R6995:Serpina9 UTSW 12 104001236 missense probably damaging 1.00
R7762:Serpina9 UTSW 12 104001316 missense probably damaging 0.98
R7808:Serpina9 UTSW 12 104001225 critical splice donor site probably null
R7860:Serpina9 UTSW 12 104001421 missense probably benign 0.01
R7935:Serpina9 UTSW 12 103998162 missense probably damaging 1.00
Z1176:Serpina9 UTSW 12 104001284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACCTTCGATGACTCAGCA -3'
(R):5'- ACCGAGTCGTTTGCTTTTGGAG -3'

Sequencing Primer
(F):5'- GAAAAGTAGCCAGTGCCTGTTTCC -3'
(R):5'- CTTTTGGAGTGGACAAGGAGC -3'
Posted On2014-11-12