Incidental Mutation 'R2413:F830016B08Rik'
ID250080
Institutional Source Beutler Lab
Gene Symbol F830016B08Rik
Ensembl Gene ENSMUSG00000090942
Gene NameRIKEN cDNA F830016B08 gene
Synonyms
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location60293380-60303016 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 60300293 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000131437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171297]
Predicted Effect probably null
Transcript: ENSMUST00000171297
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000131437
Gene: ENSMUSG00000090942
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:IIGP 35 405 1.1e-131 PFAM
Pfam:ABC_tran 68 214 7.3e-7 PFAM
Pfam:MMR_HSR1 71 197 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Cyp2c40 G T 19: 39,803,887 C204* probably null Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in F830016B08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:F830016B08Rik APN 18 60300268 missense probably damaging 1.00
IGL02642:F830016B08Rik APN 18 60299986 missense probably benign 0.00
FR4342:F830016B08Rik UTSW 18 60299941 small insertion probably benign
R0172:F830016B08Rik UTSW 18 60299964 missense possibly damaging 0.64
R0375:F830016B08Rik UTSW 18 60300193 missense probably damaging 1.00
R1517:F830016B08Rik UTSW 18 60300898 nonsense probably null
R1791:F830016B08Rik UTSW 18 60300517 missense probably benign 0.01
R2696:F830016B08Rik UTSW 18 60300736 missense possibly damaging 0.75
R3607:F830016B08Rik UTSW 18 60300708 nonsense probably null
R4612:F830016B08Rik UTSW 18 60301015 missense probably benign 0.42
R4621:F830016B08Rik UTSW 18 60300867 missense probably benign 0.01
R4752:F830016B08Rik UTSW 18 60301081 missense probably benign 0.00
R5755:F830016B08Rik UTSW 18 60300806 missense probably damaging 1.00
R5909:F830016B08Rik UTSW 18 60300019 missense probably damaging 1.00
R6183:F830016B08Rik UTSW 18 60299877 missense probably benign 0.00
R6272:F830016B08Rik UTSW 18 60300078 missense probably damaging 1.00
R7076:F830016B08Rik UTSW 18 60300471 missense probably damaging 1.00
RF044:F830016B08Rik UTSW 18 60299938 small insertion probably benign
RF054:F830016B08Rik UTSW 18 60299938 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGGAGCTGGAAAATCC -3'
(R):5'- AGCTTTGGATCTGCTTCAGG -3'

Sequencing Primer
(F):5'- GCCTCATCAATGCCCTGATAGG -3'
(R):5'- GGGCTTTTTCTCTTTCAAAAGTACG -3'
Posted On2014-11-12