Incidental Mutation 'R2413:Cyp2c40'
ID250083
Institutional Source Beutler Lab
Gene Symbol Cyp2c40
Ensembl Gene ENSMUSG00000025004
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 40
Synonyms
MMRRC Submission 040377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2413 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location39767071-39812814 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 39803887 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 204 (C204*)
Ref Sequence ENSEMBL: ENSMUSP00000125217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160476] [ENSMUST00000162507] [ENSMUST00000162630]
Predicted Effect probably null
Transcript: ENSMUST00000160476
AA Change: C204*
SMART Domains Protein: ENSMUSP00000125217
Gene: ENSMUSG00000025004
AA Change: C204*

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 516 9.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162434
Predicted Effect probably benign
Transcript: ENSMUST00000162507
SMART Domains Protein: ENSMUSP00000124618
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 120 3.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162630
SMART Domains Protein: ENSMUSP00000123884
Gene: ENSMUSG00000025004

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Pfam:p450 59 193 6.6e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163090
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,309,818 A168S probably benign Het
Aspm A C 1: 139,477,757 I1461L probably damaging Het
Bcas3 C T 11: 85,531,855 L517F probably damaging Het
Brpf3 T C 17: 28,805,950 probably benign Het
Cfap74 A C 4: 155,418,624 R24S possibly damaging Het
Clec1a T A 6: 129,435,255 S51C probably damaging Het
Dgki C A 6: 36,847,473 R1040L possibly damaging Het
F830016B08Rik T A 18: 60,300,293 Y149* probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Frmpd1 A T 4: 45,278,969 T565S probably benign Het
Heatr5b A T 17: 78,756,861 probably null Het
Ipcef1 G A 10: 6,935,225 P92S probably damaging Het
Kctd12 T A 14: 102,982,167 I92F probably damaging Het
Kntc1 C T 5: 123,764,149 T285I probably benign Het
Lipo2 A T 19: 33,751,257 N32K probably damaging Het
Mier3 T C 13: 111,715,128 probably benign Het
Myd88 T C 9: 119,337,418 T277A probably benign Het
Myo3a T A 2: 22,577,912 Y1331N probably benign Het
Neb C A 2: 52,210,632 W4422L probably damaging Het
Nfasc A G 1: 132,595,505 S1019P probably damaging Het
Npepps T C 11: 97,240,966 E354G probably damaging Het
Ntrk2 G T 13: 58,874,412 R427L possibly damaging Het
Olfr578 A G 7: 102,984,802 S121P probably damaging Het
Ptprd T A 4: 76,133,200 D262V probably damaging Het
Serpina9 C T 12: 104,001,226 probably null Het
Setd2 A G 9: 110,547,504 E129G probably damaging Het
Slc29a1 A G 17: 45,585,717 L444P probably damaging Het
Synj2 C A 17: 6,028,574 P217T probably damaging Het
Tex52 T C 6: 128,379,908 L188P probably damaging Het
Tmem63a A G 1: 180,961,075 M326V probably benign Het
Tnxb A G 17: 34,718,278 T2900A probably damaging Het
Other mutations in Cyp2c40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Cyp2c40 APN 19 39812583 missense probably benign 0.17
IGL01660:Cyp2c40 APN 19 39786810 missense probably damaging 0.99
IGL01897:Cyp2c40 APN 19 39803773 nonsense probably null
IGL01926:Cyp2c40 APN 19 39802655 missense probably benign 0.25
IGL02078:Cyp2c40 APN 19 39767482 missense probably benign 0.01
IGL02259:Cyp2c40 APN 19 39803802 missense probably benign 0.00
IGL02716:Cyp2c40 APN 19 39807536 missense possibly damaging 0.49
cypriot UTSW 19 39767455 missense probably damaging 0.98
R0269:Cyp2c40 UTSW 19 39773896 missense probably damaging 1.00
R0308:Cyp2c40 UTSW 19 39777988 missense probably damaging 1.00
R0309:Cyp2c40 UTSW 19 39778051 missense possibly damaging 0.51
R0441:Cyp2c40 UTSW 19 39807163 splice site probably benign
R1068:Cyp2c40 UTSW 19 39812581 missense possibly damaging 0.93
R1123:Cyp2c40 UTSW 19 39812677 missense probably benign 0.00
R1443:Cyp2c40 UTSW 19 39777971 missense possibly damaging 0.90
R1506:Cyp2c40 UTSW 19 39777999 missense probably damaging 0.96
R1567:Cyp2c40 UTSW 19 39803771 missense probably null 0.99
R1731:Cyp2c40 UTSW 19 39812689 missense probably damaging 1.00
R1774:Cyp2c40 UTSW 19 39786806 missense probably damaging 1.00
R1861:Cyp2c40 UTSW 19 39786875 missense probably benign 0.11
R1977:Cyp2c40 UTSW 19 39778041 missense probably damaging 1.00
R2022:Cyp2c40 UTSW 19 39812780 unclassified probably benign
R2063:Cyp2c40 UTSW 19 39786780 missense probably benign 0.01
R2359:Cyp2c40 UTSW 19 39777954 missense probably damaging 1.00
R3685:Cyp2c40 UTSW 19 39786779 missense possibly damaging 0.95
R4080:Cyp2c40 UTSW 19 39802529 missense probably benign 0.01
R4614:Cyp2c40 UTSW 19 39803856 missense probably damaging 1.00
R4661:Cyp2c40 UTSW 19 39786846 missense probably benign 0.00
R4716:Cyp2c40 UTSW 19 39802661 splice site probably null
R4799:Cyp2c40 UTSW 19 39773849 missense probably damaging 1.00
R5133:Cyp2c40 UTSW 19 39807219 missense probably benign 0.02
R5191:Cyp2c40 UTSW 19 39802591 missense probably damaging 0.96
R5310:Cyp2c40 UTSW 19 39778030 missense probably damaging 1.00
R5455:Cyp2c40 UTSW 19 39803792 missense possibly damaging 0.75
R5619:Cyp2c40 UTSW 19 39803784 missense probably damaging 1.00
R5989:Cyp2c40 UTSW 19 39807580 missense probably benign 0.45
R6175:Cyp2c40 UTSW 19 39812560 missense probably benign 0.00
R6622:Cyp2c40 UTSW 19 39802546 missense probably damaging 1.00
R6987:Cyp2c40 UTSW 19 39812767 unclassified probably benign
R7057:Cyp2c40 UTSW 19 39807619 missense probably damaging 1.00
R7485:Cyp2c40 UTSW 19 39807606 nonsense probably null
R7560:Cyp2c40 UTSW 19 39807214 missense possibly damaging 0.81
R7648:Cyp2c40 UTSW 19 39803845 makesense probably null
R7718:Cyp2c40 UTSW 19 39767338 missense probably benign 0.00
R7763:Cyp2c40 UTSW 19 39807168 missense possibly damaging 0.90
R7893:Cyp2c40 UTSW 19 39786848 missense probably damaging 0.99
R8094:Cyp2c40 UTSW 19 39802565 missense probably benign 0.17
R8094:Cyp2c40 UTSW 19 39802571 missense probably benign 0.00
R8264:Cyp2c40 UTSW 19 39807527 missense possibly damaging 0.95
R8287:Cyp2c40 UTSW 19 39767455 missense probably damaging 0.98
R8302:Cyp2c40 UTSW 19 39807622 missense probably damaging 1.00
R8848:Cyp2c40 UTSW 19 39812800 missense unknown
R8915:Cyp2c40 UTSW 19 39807547 missense probably benign 0.31
R8963:Cyp2c40 UTSW 19 39767482 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTGAAGTACTTGTCTGACATGTCTC -3'
(R):5'- ATTCTTCAGCATGTAAGTACCTAGC -3'

Sequencing Primer
(F):5'- AGTACTTGTCTGACATGTCTCTATTG -3'
(R):5'- CAGCATGTAAGTACCTAGCAGTTAAG -3'
Posted On2014-11-12