Incidental Mutation 'R2414:AU040320'
ID250096
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
MMRRC Submission 040378-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2414 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 126868691 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102607] [ENSMUST00000102607] [ENSMUST00000102608] [ENSMUST00000102608] [ENSMUST00000106108]
Predicted Effect probably null
Transcript: ENSMUST00000102607
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102607
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102608
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102608
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106108
SMART Domains Protein: ENSMUSP00000101714
Gene: ENSMUSG00000042446

DomainStartEndE-ValueType
TRASH 341 377 6.53e-4 SMART
TRASH 389 429 7.22e-6 SMART
TRASH 441 479 1.77e0 SMART
TRASH 486 525 4.95e-4 SMART
TRASH 531 569 1.05e-2 SMART
TRASH 579 615 2.82e1 SMART
low complexity region 640 649 N/A INTRINSIC
TRASH 687 723 8.49e-3 SMART
TRASH 729 764 1.14e-3 SMART
TRASH 772 810 4.48e-2 SMART
TRASH 816 851 2.06e-1 SMART
low complexity region 974 993 N/A INTRINSIC
low complexity region 1002 1021 N/A INTRINSIC
Pfam:DUF3504 1357 1527 1.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135003
SMART Domains Protein: ENSMUSP00000120813
Gene: ENSMUSG00000042446

DomainStartEndE-ValueType
TRASH 90 126 6.53e-4 SMART
TRASH 138 178 7.22e-6 SMART
TRASH 190 228 1.77e0 SMART
TRASH 235 274 3.05e-4 SMART
low complexity region 300 309 N/A INTRINSIC
TRASH 347 383 8.49e-3 SMART
TRASH 389 424 1.14e-3 SMART
TRASH 432 470 4.48e-2 SMART
TRASH 476 511 2.06e-1 SMART
low complexity region 634 653 N/A INTRINSIC
low complexity region 662 681 N/A INTRINSIC
Pfam:DUF3504 1017 1187 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150467
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr2 C A 9: 121,908,974 S138R probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Arfgef2 A G 2: 166,845,504 E216G probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
BC002059 T C 17: 16,973,670 noncoding transcript Het
Cep112 A G 11: 108,752,582 N799S possibly damaging Het
Cilp A G 9: 65,274,645 probably benign Het
Cpn2 T C 16: 30,260,574 E103G probably benign Het
Cpt1b G A 15: 89,420,080 probably benign Het
Epor T A 9: 21,959,489 D365V probably damaging Het
Hip1r T C 5: 124,001,243 Y900H probably damaging Het
Hist2h2be T A 3: 96,221,434 I90N possibly damaging Het
Hoxc9 A T 15: 102,984,108 N251I probably damaging Het
Hpd C T 5: 123,177,524 probably null Het
Lrrc34 T A 3: 30,634,562 I197L probably benign Het
Msi2 A G 11: 88,716,547 V78A probably damaging Het
Myh4 A G 11: 67,250,768 I818V probably benign Het
Nol4 T C 18: 22,823,572 probably null Het
Plekha5 A G 6: 140,550,856 N362S probably damaging Het
Polr1b A G 2: 129,103,134 probably benign Het
Rc3h2 A T 2: 37,399,819 probably null Het
Sgsm3 A G 15: 81,006,745 N136D probably benign Het
Slco1a5 A G 6: 142,236,250 C583R probably damaging Het
Surf1 A G 2: 26,916,283 W13R probably damaging Het
Tesk2 T C 4: 116,801,757 W276R possibly damaging Het
Tmem8b A G 4: 43,673,892 probably benign Het
Togaram2 T G 17: 71,716,309 probably benign Het
Ttll11 A G 2: 35,979,534 S31P unknown Het
Ttll8 A G 15: 88,936,133 probably benign Het
Tub A G 7: 109,027,033 K259E probably damaging Het
Ube2o T C 11: 116,548,857 I162M probably benign Het
Vamp8 C T 6: 72,388,343 M1I probably null Het
Zfp503 C A 14: 21,985,964 G295* probably null Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Z1177:AU040320 UTSW 4 126842633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGAATCTACCCAACTAAATCGGGG -3'
(R):5'- GCCCATTGTCCTGTTAAACACC -3'

Sequencing Primer
(F):5'- TTTGAACTCAGGACCTCTGGAAG -3'
(R):5'- GACTCTGAAGTACAGCAC -3'
Posted On2014-11-12