Mutagenetix > Incidental Mutation

Incidental Mutation 'R2414:Cilp'

250108

Institutional Source

Beutler Lab

Gene Symbol

Cilp

Ensembl Gene

ENSMUSG00000042254

Gene Name

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

Synonyms

C130036G17Rik

MMRRC Submission

040378-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65172462-65187887 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 65181927 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121326 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048762

SMART Domains

Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Mucin2_WxxW	55	139	1.9e-24	PFAM
TSP1	152	201	3.09e-10	SMART
low complexity region	233	242	N/A	INTRINSIC
IGc2	321	383	4.45e-10	SMART
low complexity region	1154	1170	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141382

SMART Domains

Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ackr2	C	A	9: 121,738,040 (GRCm39)	S138R	probably damaging	Het
Alpk3	C	A	7: 80,742,501 (GRCm39)	P773T	probably benign	Het
Arfgef2	A	G	2: 166,687,424 (GRCm39)	E216G	probably benign	Het
Aspscr1	T	C	11: 120,580,048 (GRCm39)	S196P	probably benign	Het
AU040320	A	T	4: 126,762,484 (GRCm39)		probably null	Het
BC002059	T	C	17: 17,193,932 (GRCm39)		noncoding transcript	Het
Cep112	A	G	11: 108,643,408 (GRCm39)	N799S	possibly damaging	Het
Cpn2	T	C	16: 30,079,392 (GRCm39)	E103G	probably benign	Het
Cpt1b	G	A	15: 89,304,283 (GRCm39)		probably benign	Het
Epor	T	A	9: 21,870,785 (GRCm39)	D365V	probably damaging	Het
H2bc21	T	A	3: 96,128,750 (GRCm39)	I90N	possibly damaging	Het
Hip1r	T	C	5: 124,139,306 (GRCm39)	Y900H	probably damaging	Het
Hoxc9	A	T	15: 102,892,540 (GRCm39)	N251I	probably damaging	Het
Hpd	C	T	5: 123,315,587 (GRCm39)		probably null	Het
Lrrc34	T	A	3: 30,688,711 (GRCm39)	I197L	probably benign	Het
Msi2	A	G	11: 88,607,373 (GRCm39)	V78A	probably damaging	Het
Myh4	A	G	11: 67,141,594 (GRCm39)	I818V	probably benign	Het
Nol4	T	C	18: 22,956,629 (GRCm39)		probably null	Het
Plekha5	A	G	6: 140,496,582 (GRCm39)	N362S	probably damaging	Het
Polr1b	A	G	2: 128,945,054 (GRCm39)		probably benign	Het
Rc3h2	A	T	2: 37,289,831 (GRCm39)		probably null	Het
Sgsm3	A	G	15: 80,890,946 (GRCm39)	N136D	probably benign	Het
Slco1a5	A	G	6: 142,181,976 (GRCm39)	C583R	probably damaging	Het
Surf1	A	G	2: 26,806,295 (GRCm39)	W13R	probably damaging	Het
Tesk2	T	C	4: 116,658,954 (GRCm39)	W276R	possibly damaging	Het
Tmem8b	A	G	4: 43,673,892 (GRCm39)		probably benign	Het
Togaram2	T	G	17: 72,023,304 (GRCm39)		probably benign	Het
Ttll11	A	G	2: 35,869,546 (GRCm39)	S31P	unknown	Het
Ttll8	A	G	15: 88,820,336 (GRCm39)		probably benign	Het
Tub	A	G	7: 108,626,240 (GRCm39)	K259E	probably damaging	Het
Ube2o	T	C	11: 116,439,683 (GRCm39)	I162M	probably benign	Het
Vamp8	C	T	6: 72,365,326 (GRCm39)	M1I	probably null	Het
Zfp503	C	A	14: 22,036,032 (GRCm39)	G295*	probably null	Het

Other mutations in Cilp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01291:Cilp	APN	9	65,186,265 (GRCm39)	missense	possibly damaging	0.80
IGL01340:Cilp	APN	9	65,183,256 (GRCm39)	missense	probably damaging	0.99
IGL02330:Cilp	APN	9	65,181,804 (GRCm39)	splice site	probably benign
IGL02729:Cilp	APN	9	65,185,372 (GRCm39)	missense	possibly damaging	0.63
IGL02833:Cilp	APN	9	65,185,206 (GRCm39)	missense	probably benign
IGL02961:Cilp	APN	9	65,185,891 (GRCm39)	missense	possibly damaging	0.88
IGL03137:Cilp	APN	9	65,185,450 (GRCm39)	missense	probably benign
IGL03211:Cilp	APN	9	65,187,457 (GRCm39)	missense	probably benign
IGL03301:Cilp	APN	9	65,187,499 (GRCm39)	missense	probably benign	0.01
IGL03341:Cilp	APN	9	65,185,284 (GRCm39)	missense	probably benign	0.07
ANU05:Cilp	UTSW	9	65,186,265 (GRCm39)	missense	possibly damaging	0.80
IGL02984:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL02988:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL02991:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03014:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03050:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03054:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03055:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03097:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03098:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03134:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03138:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
IGL03147:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
R0096:Cilp	UTSW	9	65,180,952 (GRCm39)	missense	possibly damaging	0.57
R0219:Cilp	UTSW	9	65,176,872 (GRCm39)	missense	possibly damaging	0.64
R0347:Cilp	UTSW	9	65,187,435 (GRCm39)	missense	probably benign
R0699:Cilp	UTSW	9	65,177,608 (GRCm39)	missense	probably damaging	1.00
R1148:Cilp	UTSW	9	65,187,598 (GRCm39)	missense	possibly damaging	0.96
R1148:Cilp	UTSW	9	65,187,598 (GRCm39)	missense	possibly damaging	0.96
R1155:Cilp	UTSW	9	65,176,869 (GRCm39)	missense	probably benign	0.01
R1544:Cilp	UTSW	9	65,183,127 (GRCm39)	missense	probably benign	0.03
R1584:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R1586:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R2055:Cilp	UTSW	9	65,186,997 (GRCm39)	missense	probably damaging	1.00
R2069:Cilp	UTSW	9	65,185,372 (GRCm39)	missense	possibly damaging	0.63
R2070:Cilp	UTSW	9	65,186,377 (GRCm39)	missense	probably damaging	1.00
R4284:Cilp	UTSW	9	65,185,560 (GRCm39)	missense	probably damaging	1.00
R4630:Cilp	UTSW	9	65,187,162 (GRCm39)	missense	probably benign	0.17
R4632:Cilp	UTSW	9	65,187,162 (GRCm39)	missense	probably benign	0.17
R4870:Cilp	UTSW	9	65,186,980 (GRCm39)	missense	probably damaging	1.00
R4908:Cilp	UTSW	9	65,185,302 (GRCm39)	missense	probably benign	0.17
R5568:Cilp	UTSW	9	65,187,515 (GRCm39)	missense	probably benign	0.04
R5621:Cilp	UTSW	9	65,186,073 (GRCm39)	missense	possibly damaging	0.71
R5889:Cilp	UTSW	9	65,187,625 (GRCm39)	missense	possibly damaging	0.93
R6645:Cilp	UTSW	9	65,186,587 (GRCm39)	missense	possibly damaging	0.66
R6878:Cilp	UTSW	9	65,187,129 (GRCm39)	missense	probably damaging	1.00
R6982:Cilp	UTSW	9	65,187,087 (GRCm39)	missense	probably damaging	1.00
R7330:Cilp	UTSW	9	65,187,527 (GRCm39)	missense	probably benign
R7967:Cilp	UTSW	9	65,185,494 (GRCm39)	missense	possibly damaging	0.80
R8305:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8306:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8307:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8308:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8386:Cilp	UTSW	9	65,186,286 (GRCm39)	missense	probably damaging	0.98
R8407:Cilp	UTSW	9	65,181,898 (GRCm39)	missense	probably damaging	1.00
R8542:Cilp	UTSW	9	65,185,405 (GRCm39)	missense	probably damaging	1.00
R8794:Cilp	UTSW	9	65,186,535 (GRCm39)	missense	probably benign	0.26
R8951:Cilp	UTSW	9	65,180,220 (GRCm39)	missense	probably benign	0.01
R9060:Cilp	UTSW	9	65,186,302 (GRCm39)	missense	probably benign	0.01
R9257:Cilp	UTSW	9	65,174,451 (GRCm39)	missense	possibly damaging	0.72
R9265:Cilp	UTSW	9	65,187,333 (GRCm39)	missense	probably benign
R9358:Cilp	UTSW	9	65,183,269 (GRCm39)	missense	probably benign
R9401:Cilp	UTSW	9	65,185,381 (GRCm39)	missense	probably damaging	0.98
X0024:Cilp	UTSW	9	65,186,925 (GRCm39)	missense	probably damaging	1.00
X0025:Cilp	UTSW	9	65,186,980 (GRCm39)	missense	probably damaging	1.00
Z1088:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
Z1176:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null
Z1177:Cilp	UTSW	9	65,187,412 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TAGAGCCTGTCACAGAGTAGG -3'
(R):5'- GCTCTGGTTGCTAAGAGAACTAGG -3'

Sequencing Primer
(F):5'- GCCTGTCACAGAGTAGGAAAACC -3'
(R):5'- GAGGTCCTGAGTTAAATTCCCAGC -3'

Posted On

2014-11-12