Mutagenetix > Incidental Mutation

Incidental Mutation 'R2425:Astn1'

250125

Institutional Source

Beutler Lab

Gene Symbol

Astn1

Ensembl Gene

ENSMUSG00000026587

Gene Name

astrotactin 1

Synonyms

MMRRC Submission

040387-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R2425 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158189843-158519351 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 158407236 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 562 (S562A)

Ref Sequence

ENSEMBL: ENSMUSP00000039711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]

AlphaFold

Q61137

Predicted Effect

probably damaging
Transcript: ENSMUST00000046110
AA Change: S562A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: S562A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000170718
AA Change: S570A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: S570A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
Blast:MACPF	811	835	3e-7	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000193042
AA Change: S570A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: S570A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	507	1.2e1	SMART
EGF	611	652	2.29e1	SMART
EGF_like	659	708	3.57e1	SMART
MACPF	811	999	1.11e-56	SMART
FN3	1030	1142	5.75e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193599
AA Change: S60A

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587
AA Change: S60A

Domain	Start	End	E-Value	Type
EGF	101	142	1.1e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194369
AA Change: S562A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: S562A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
Blast:MACPF	803	828	2e-7	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000195311
AA Change: S562A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: S562A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
transmembrane domain	153	175	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
transmembrane domain	388	410	N/A	INTRINSIC
EGF	462	499	2e-2	SMART
EGF	603	644	1.1e-1	SMART
EGF_like	651	700	1.7e-1	SMART
MACPF	803	991	6.2e-59	SMART
FN3	1022	1134	2.8e-4	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	C	7: 119,959,033 (GRCm39)	F621S	probably damaging	Het
Abcc10	A	G	17: 46,621,083 (GRCm39)	Y976H	probably damaging	Het
Abhd6	T	A	14: 8,049,857 (GRCm38)	N215K	probably benign	Het
Adcy4	T	C	14: 56,015,474 (GRCm39)	T479A	probably damaging	Het
Amacr	A	G	15: 10,983,454 (GRCm39)	Q88R	possibly damaging	Het
Ankrd11	T	A	8: 123,619,902 (GRCm39)	I1317F	possibly damaging	Het
Ano3	C	A	2: 110,693,188 (GRCm39)	A137S	probably benign	Het
Cd44	T	A	2: 102,691,931 (GRCm39)	Y119F	probably damaging	Het
CN725425	A	C	15: 91,130,058 (GRCm39)	D307A	probably damaging	Het
Col12a1	T	C	9: 79,585,648 (GRCm39)	Y1243C	probably damaging	Het
Cyp2c50	T	C	19: 40,078,292 (GRCm39)	I50T	probably benign	Het
Dhrs9	A	G	2: 69,223,308 (GRCm39)	K19E	probably benign	Het
Dnajb14	T	G	3: 137,598,666 (GRCm39)	F135V	probably null	Het
Draxin	T	A	4: 148,197,213 (GRCm39)	T195S	possibly damaging	Het
Elane	C	T	10: 79,723,610 (GRCm39)	R192C	probably benign	Het
Fam171a2	A	C	11: 102,329,187 (GRCm39)	I524S	possibly damaging	Het
Fbxo10	C	T	4: 45,051,642 (GRCm39)	E490K	possibly damaging	Het
Fkbp15	T	C	4: 62,230,602 (GRCm39)	T704A	probably benign	Het
Fndc1	T	A	17: 8,023,850 (GRCm39)	D35V	probably damaging	Het
Galntl5	A	G	5: 25,425,079 (GRCm39)	K366E	probably damaging	Het
Gas7	G	A	11: 67,534,121 (GRCm39)	A74T	probably benign	Het
Gjd4	G	T	18: 9,280,811 (GRCm39)	S89*	probably null	Het
Gldc	T	A	19: 30,109,190 (GRCm39)	N583Y	probably damaging	Het
Gpr161	T	A	1: 165,138,192 (GRCm39)	S259R	possibly damaging	Het
Igfn1	T	A	1: 135,890,840 (GRCm39)	T2387S	probably damaging	Het
Il3	A	T	11: 54,156,375 (GRCm39)	V119D	possibly damaging	Het
Ints3	T	C	3: 90,301,417 (GRCm39)	T822A	possibly damaging	Het
Jakmip1	C	T	5: 37,299,149 (GRCm39)	Q790*	probably null	Het
Kcne1	A	G	16: 92,145,646 (GRCm39)	I66T	probably damaging	Het
Nipbl	A	G	15: 8,380,966 (GRCm39)	S609P	probably benign	Het
Or10d5	T	C	9: 39,861,137 (GRCm39)	E310G	probably null	Het
Or2t48	A	G	11: 58,420,137 (GRCm39)	I225T	probably damaging	Het
Or8k21	A	G	2: 86,144,739 (GRCm39)	V297A	probably damaging	Het
Pdxdc1	A	T	16: 13,697,372 (GRCm39)	S103T	possibly damaging	Het
Pla2g2a	C	A	4: 138,560,229 (GRCm39)	A24E	possibly damaging	Het
Plxna2	C	T	1: 194,431,625 (GRCm39)	S538F	probably damaging	Het
Pramel1	T	G	4: 143,125,036 (GRCm39)	L320R	probably damaging	Het
Rad23b	T	A	4: 55,385,438 (GRCm39)	I325N	probably damaging	Het
Rasgrp1	C	G	2: 117,119,931 (GRCm39)		probably null	Het
Rbm12b1	T	A	4: 12,146,443 (GRCm39)	I805N	probably damaging	Het
Shld2	A	G	14: 33,990,646 (GRCm39)	S87P	probably damaging	Het
Slc12a9	G	T	5: 137,313,859 (GRCm39)	A700E	probably damaging	Het
Tbc1d24	A	T	17: 24,404,982 (GRCm39)	V54E	probably damaging	Het
Tmc8	A	G	11: 117,683,395 (GRCm39)	D650G	probably damaging	Het
Upf1	C	T	8: 70,791,110 (GRCm39)	R544H	probably damaging	Het
Ush2a	T	A	1: 188,270,001 (GRCm39)	N1749K	possibly damaging	Het
Usp42	T	C	5: 143,701,594 (GRCm39)	T810A	probably benign	Het
Wdr70	C	A	15: 7,916,840 (GRCm39)	E526*	probably null	Het
Zfp935	G	T	13: 62,602,922 (GRCm39)	Q93K	probably benign	Het

Other mutations in Astn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:Astn1	APN	1	158,427,889 (GRCm39)	missense	possibly damaging	0.71
IGL01705:Astn1	APN	1	158,331,883 (GRCm39)	missense	probably damaging	1.00
IGL01790:Astn1	APN	1	158,407,897 (GRCm39)	missense	possibly damaging	0.70
IGL01962:Astn1	APN	1	158,496,201 (GRCm39)	missense	probably damaging	1.00
IGL02000:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02119:Astn1	APN	1	158,338,724 (GRCm39)	intron	probably benign
IGL02168:Astn1	APN	1	158,436,911 (GRCm39)	missense	possibly damaging	0.93
IGL02239:Astn1	APN	1	158,491,700 (GRCm39)	critical splice donor site	probably null
IGL02271:Astn1	APN	1	158,338,520 (GRCm39)	splice site	probably benign
IGL02307:Astn1	APN	1	158,502,184 (GRCm39)	missense	probably damaging	1.00
IGL02504:Astn1	APN	1	158,329,978 (GRCm39)	missense	probably damaging	1.00
IGL02552:Astn1	APN	1	158,332,965 (GRCm39)	missense	possibly damaging	0.90
IGL02903:Astn1	APN	1	158,516,120 (GRCm39)	missense	probably damaging	0.99
IGL03003:Astn1	APN	1	158,439,965 (GRCm39)	missense	probably benign	0.00
IGL03007:Astn1	APN	1	158,496,193 (GRCm39)	splice site	probably benign
IGL03354:Astn1	APN	1	158,516,174 (GRCm39)	missense	probably damaging	1.00
PIT4366001:Astn1	UTSW	1	158,424,781 (GRCm39)	missense	probably benign	0.23
PIT4366001:Astn1	UTSW	1	158,424,779 (GRCm39)	missense	probably benign	0.20
R0024:Astn1	UTSW	1	158,511,785 (GRCm39)	missense	probably damaging	0.99
R0050:Astn1	UTSW	1	158,407,294 (GRCm39)	splice site	probably benign
R0099:Astn1	UTSW	1	158,329,721 (GRCm39)	missense	probably damaging	1.00
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0109:Astn1	UTSW	1	158,491,674 (GRCm39)	missense	possibly damaging	0.79
R0365:Astn1	UTSW	1	158,516,118 (GRCm39)	missense	probably damaging	1.00
R0416:Astn1	UTSW	1	158,337,461 (GRCm39)	missense	probably damaging	1.00
R0531:Astn1	UTSW	1	158,427,959 (GRCm39)	missense	probably damaging	0.99
R0735:Astn1	UTSW	1	158,299,959 (GRCm39)	missense	possibly damaging	0.53
R0763:Astn1	UTSW	1	158,337,460 (GRCm39)	missense	possibly damaging	0.93
R0899:Astn1	UTSW	1	158,338,679 (GRCm39)	nonsense	probably null
R1027:Astn1	UTSW	1	158,407,849 (GRCm39)	missense	probably damaging	1.00
R1160:Astn1	UTSW	1	158,427,935 (GRCm39)	missense	possibly damaging	0.83
R1474:Astn1	UTSW	1	158,329,923 (GRCm39)	missense	probably damaging	1.00
R1517:Astn1	UTSW	1	158,407,146 (GRCm39)	splice site	probably benign
R1701:Astn1	UTSW	1	158,331,877 (GRCm39)	missense	possibly damaging	0.54
R1764:Astn1	UTSW	1	158,331,821 (GRCm39)	missense	probably benign	0.35
R1860:Astn1	UTSW	1	158,429,515 (GRCm39)	missense	probably damaging	1.00
R1889:Astn1	UTSW	1	158,332,886 (GRCm39)	splice site	probably null
R1919:Astn1	UTSW	1	158,337,541 (GRCm39)	missense	probably damaging	1.00
R2001:Astn1	UTSW	1	158,348,091 (GRCm39)	missense	probably damaging	1.00
R2007:Astn1	UTSW	1	158,436,875 (GRCm39)	missense	probably damaging	0.97
R2038:Astn1	UTSW	1	158,484,690 (GRCm39)	missense	probably benign	0.29
R2044:Astn1	UTSW	1	158,428,072 (GRCm39)	missense	possibly damaging	0.53
R2084:Astn1	UTSW	1	158,299,978 (GRCm39)	missense	probably damaging	0.99
R2094:Astn1	UTSW	1	158,495,179 (GRCm39)	missense	probably benign	0.02
R2163:Astn1	UTSW	1	158,329,720 (GRCm39)	missense	probably damaging	0.99
R2211:Astn1	UTSW	1	158,484,876 (GRCm39)	missense	probably benign	0.40
R2268:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2269:Astn1	UTSW	1	158,329,669 (GRCm39)	missense	probably damaging	1.00
R2428:Astn1	UTSW	1	158,439,916 (GRCm39)	missense	possibly damaging	0.66
R2980:Astn1	UTSW	1	158,400,521 (GRCm39)	critical splice acceptor site	probably null
R3713:Astn1	UTSW	1	158,495,102 (GRCm39)	missense	possibly damaging	0.83
R3745:Astn1	UTSW	1	158,329,630 (GRCm39)	missense	probably damaging	1.00
R3926:Astn1	UTSW	1	158,407,227 (GRCm39)	missense	possibly damaging	0.95
R4345:Astn1	UTSW	1	158,329,602 (GRCm39)	splice site	probably null
R4625:Astn1	UTSW	1	158,407,864 (GRCm39)	missense	probably damaging	1.00
R4627:Astn1	UTSW	1	158,329,821 (GRCm39)	missense	possibly damaging	0.55
R4970:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5112:Astn1	UTSW	1	158,484,763 (GRCm39)	missense	possibly damaging	0.88
R5257:Astn1	UTSW	1	158,440,102 (GRCm39)	missense	probably damaging	1.00
R5292:Astn1	UTSW	1	158,407,933 (GRCm39)	critical splice donor site	probably null
R5889:Astn1	UTSW	1	158,427,950 (GRCm39)	missense	possibly damaging	0.93
R5909:Astn1	UTSW	1	158,429,507 (GRCm39)	missense	probably damaging	1.00
R6020:Astn1	UTSW	1	158,337,563 (GRCm39)	missense	probably damaging	1.00
R6349:Astn1	UTSW	1	158,491,691 (GRCm39)	nonsense	probably null
R6481:Astn1	UTSW	1	158,440,032 (GRCm39)	missense	probably benign	0.29
R6736:Astn1	UTSW	1	158,338,718 (GRCm39)	critical splice donor site	probably null
R6833:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6834:Astn1	UTSW	1	158,491,692 (GRCm39)	missense	probably benign	0.40
R6860:Astn1	UTSW	1	158,440,042 (GRCm39)	missense	probably damaging	1.00
R6874:Astn1	UTSW	1	158,491,644 (GRCm39)	nonsense	probably null
R7062:Astn1	UTSW	1	158,516,081 (GRCm39)	critical splice acceptor site	probably null
R7133:Astn1	UTSW	1	158,400,557 (GRCm39)	missense	probably damaging	1.00
R7355:Astn1	UTSW	1	158,491,846 (GRCm39)	splice site	probably null
R7402:Astn1	UTSW	1	158,380,425 (GRCm39)	intron	probably benign
R7412:Astn1	UTSW	1	158,329,919 (GRCm39)	missense	probably damaging	0.98
R7487:Astn1	UTSW	1	158,438,352 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,495,208 (GRCm39)	splice site	probably null
R7537:Astn1	UTSW	1	158,332,956 (GRCm39)	missense	possibly damaging	0.84
R7635:Astn1	UTSW	1	158,495,105 (GRCm39)	nonsense	probably null
R7890:Astn1	UTSW	1	158,407,903 (GRCm39)	missense	probably damaging	1.00
R7894:Astn1	UTSW	1	158,429,508 (GRCm39)	missense	probably damaging	0.98
R7904:Astn1	UTSW	1	158,424,886 (GRCm39)	missense	probably benign	0.37
R8048:Astn1	UTSW	1	158,516,208 (GRCm39)	missense	probably benign	0.00
R8061:Astn1	UTSW	1	158,331,920 (GRCm39)	critical splice donor site	probably null
R8096:Astn1	UTSW	1	158,436,890 (GRCm39)	missense	probably damaging	1.00
R8327:Astn1	UTSW	1	158,436,850 (GRCm39)	missense	probably damaging	1.00
R8374:Astn1	UTSW	1	158,329,803 (GRCm39)	missense	probably damaging	1.00
R8400:Astn1	UTSW	1	158,484,670 (GRCm39)	missense	probably benign	0.09
R8983:Astn1	UTSW	1	158,491,700 (GRCm39)	critical splice donor site	probably null
R9013:Astn1	UTSW	1	158,348,070 (GRCm39)	missense	probably damaging	1.00
R9110:Astn1	UTSW	1	158,496,327 (GRCm39)	missense	probably benign	0.01
R9156:Astn1	UTSW	1	158,338,555 (GRCm39)	missense	probably damaging	0.99
R9355:Astn1	UTSW	1	158,511,721 (GRCm39)	missense	probably damaging	1.00
R9683:Astn1	UTSW	1	158,491,619 (GRCm39)	missense	possibly damaging	0.93
Z1088:Astn1	UTSW	1	158,511,666 (GRCm39)	nonsense	probably null
Z1088:Astn1	UTSW	1	158,424,776 (GRCm39)	missense	possibly damaging	0.91
Z1088:Astn1	UTSW	1	158,300,067 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- CCCTGTAGCATCACCTGGTATG -3'
(R):5'- AGCAGACTCTGGCTGTGTATATAG -3'

Sequencing Primer
(F):5'- GTAGCATCACCTGGTATGTGCATAC -3'
(R):5'- CTCTGGCTGTGTATATAGAGAAATTG -3'

Posted On

2014-11-12