Incidental Mutation 'R2425:Rad23b'
ID 250139
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene Name RAD23 homolog B, nucleotide excision repair protein
Synonyms mHR23B, 0610007D13Rik
MMRRC Submission 040387-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2425 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 55350043-55392237 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55385438 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 325 (I325N)
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
AlphaFold P54728
PDB Structure The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030134
AA Change: I325N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426
AA Change: I325N

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,959,033 (GRCm39) F621S probably damaging Het
Abcc10 A G 17: 46,621,083 (GRCm39) Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 (GRCm38) N215K probably benign Het
Adcy4 T C 14: 56,015,474 (GRCm39) T479A probably damaging Het
Amacr A G 15: 10,983,454 (GRCm39) Q88R possibly damaging Het
Ankrd11 T A 8: 123,619,902 (GRCm39) I1317F possibly damaging Het
Ano3 C A 2: 110,693,188 (GRCm39) A137S probably benign Het
Astn1 T G 1: 158,407,236 (GRCm39) S562A probably damaging Het
Cd44 T A 2: 102,691,931 (GRCm39) Y119F probably damaging Het
CN725425 A C 15: 91,130,058 (GRCm39) D307A probably damaging Het
Col12a1 T C 9: 79,585,648 (GRCm39) Y1243C probably damaging Het
Cyp2c50 T C 19: 40,078,292 (GRCm39) I50T probably benign Het
Dhrs9 A G 2: 69,223,308 (GRCm39) K19E probably benign Het
Dnajb14 T G 3: 137,598,666 (GRCm39) F135V probably null Het
Draxin T A 4: 148,197,213 (GRCm39) T195S possibly damaging Het
Elane C T 10: 79,723,610 (GRCm39) R192C probably benign Het
Fam171a2 A C 11: 102,329,187 (GRCm39) I524S possibly damaging Het
Fbxo10 C T 4: 45,051,642 (GRCm39) E490K possibly damaging Het
Fkbp15 T C 4: 62,230,602 (GRCm39) T704A probably benign Het
Fndc1 T A 17: 8,023,850 (GRCm39) D35V probably damaging Het
Galntl5 A G 5: 25,425,079 (GRCm39) K366E probably damaging Het
Gas7 G A 11: 67,534,121 (GRCm39) A74T probably benign Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Gldc T A 19: 30,109,190 (GRCm39) N583Y probably damaging Het
Gpr161 T A 1: 165,138,192 (GRCm39) S259R possibly damaging Het
Igfn1 T A 1: 135,890,840 (GRCm39) T2387S probably damaging Het
Il3 A T 11: 54,156,375 (GRCm39) V119D possibly damaging Het
Ints3 T C 3: 90,301,417 (GRCm39) T822A possibly damaging Het
Jakmip1 C T 5: 37,299,149 (GRCm39) Q790* probably null Het
Kcne1 A G 16: 92,145,646 (GRCm39) I66T probably damaging Het
Nipbl A G 15: 8,380,966 (GRCm39) S609P probably benign Het
Or10d5 T C 9: 39,861,137 (GRCm39) E310G probably null Het
Or2t48 A G 11: 58,420,137 (GRCm39) I225T probably damaging Het
Or8k21 A G 2: 86,144,739 (GRCm39) V297A probably damaging Het
Pdxdc1 A T 16: 13,697,372 (GRCm39) S103T possibly damaging Het
Pla2g2a C A 4: 138,560,229 (GRCm39) A24E possibly damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pramel1 T G 4: 143,125,036 (GRCm39) L320R probably damaging Het
Rasgrp1 C G 2: 117,119,931 (GRCm39) probably null Het
Rbm12b1 T A 4: 12,146,443 (GRCm39) I805N probably damaging Het
Shld2 A G 14: 33,990,646 (GRCm39) S87P probably damaging Het
Slc12a9 G T 5: 137,313,859 (GRCm39) A700E probably damaging Het
Tbc1d24 A T 17: 24,404,982 (GRCm39) V54E probably damaging Het
Tmc8 A G 11: 117,683,395 (GRCm39) D650G probably damaging Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Ush2a T A 1: 188,270,001 (GRCm39) N1749K possibly damaging Het
Usp42 T C 5: 143,701,594 (GRCm39) T810A probably benign Het
Wdr70 C A 15: 7,916,840 (GRCm39) E526* probably null Het
Zfp935 G T 13: 62,602,922 (GRCm39) Q93K probably benign Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55,366,774 (GRCm39) splice site probably benign
IGL01326:Rad23b APN 4 55,383,601 (GRCm39) missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55,350,360 (GRCm39) utr 5 prime probably benign
IGL02506:Rad23b APN 4 55,382,511 (GRCm39) missense probably benign 0.01
IGL02538:Rad23b APN 4 55,370,457 (GRCm39) missense possibly damaging 0.67
Saguaro UTSW 4 55,370,474 (GRCm39) critical splice donor site probably null
R0278:Rad23b UTSW 4 55,383,575 (GRCm39) splice site probably null
R1846:Rad23b UTSW 4 55,383,637 (GRCm39) nonsense probably null
R2198:Rad23b UTSW 4 55,385,497 (GRCm39) missense possibly damaging 0.68
R3774:Rad23b UTSW 4 55,382,589 (GRCm39) missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55,382,586 (GRCm39) missense probably damaging 1.00
R4197:Rad23b UTSW 4 55,385,455 (GRCm39) missense probably damaging 0.98
R5911:Rad23b UTSW 4 55,370,474 (GRCm39) critical splice donor site probably null
R6056:Rad23b UTSW 4 55,382,540 (GRCm39) missense probably benign 0.01
R6067:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R6078:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R6079:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
R7426:Rad23b UTSW 4 55,370,469 (GRCm39) missense probably benign 0.00
U15987:Rad23b UTSW 4 55,370,400 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATTTACCTTTCAGAACTGTTGTG -3'
(R):5'- TGGTAGCAGGAGCCACTAGC -3'

Sequencing Primer
(F):5'- TATGACTCAGCCATGCCTAAGATG -3'
(R):5'- AGCCACTAGCCCAGGTG -3'
Posted On 2014-11-12