Incidental Mutation 'R2425:Elane'
ID250157
Institutional Source Beutler Lab
Gene Symbol Elane
Ensembl Gene ENSMUSG00000020125
Gene Nameelastase, neutrophil expressed
SynonymsNE, Ela2, F430011M15Rik
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2425 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79886247-79888215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79887776 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 192 (R192C)
Ref Sequence ENSEMBL: ENSMUSP00000038925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006679] [ENSMUST00000046091] [ENSMUST00000061653] [ENSMUST00000217837]
Predicted Effect probably benign
Transcript: ENSMUST00000006679
SMART Domains Protein: ENSMUSP00000006679
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Tryp_SPc 29 245 2.1e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000046091
AA Change: R192C

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038925
Gene: ENSMUSG00000020125
AA Change: R192C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Tryp_SPc 28 242 3.74e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061653
SMART Domains Protein: ENSMUSP00000056836
Gene: ENSMUSG00000061780

DomainStartEndE-ValueType
Tryp_SPc 25 249 8.25e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165982
Predicted Effect probably benign
Transcript: ENSMUST00000166201
SMART Domains Protein: ENSMUSP00000129585
Gene: ENSMUSG00000057729

DomainStartEndE-ValueType
Tryp_SPc 5 125 1.26e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171489
Predicted Effect probably benign
Transcript: ENSMUST00000217837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218521
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chymotrypsin-like family of serine protease enzymes that hydrolyzes a broad range of protein substrates including elastin. This gene is expressed by neutrophils where the encoded enzyme is stored in azurophil granules. Upon neutrophil activation, the active enzyme is released into the extracellular mileu. Mice lacking the encoded protein exhibit increased susceptibility to sepsis and death following intraperitoneal infection with Gram negative bacteria. This gene is located adjacent to a related proteinase gene on chromosome 10. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show impaired neutrophil physiology, susceptibility to Gram (-) bacterial infection, reduced sensitivity to xenobiotics, and abnormal local Shwartzman responses. Homozygotes for a knock-in allele show susceptibility to fungal infection and resistance to endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Elane
AlleleSourceChrCoordTypePredicted EffectPPH Score
Ruo UTSW 10 79887108 missense probably damaging 1.00
R0167:Elane UTSW 10 79887099 unclassified probably null
R0639:Elane UTSW 10 79886349 missense possibly damaging 0.53
R0837:Elane UTSW 10 79887108 missense probably damaging 1.00
R2001:Elane UTSW 10 79887759 missense possibly damaging 0.90
R4751:Elane UTSW 10 79886791 missense probably benign 0.00
R5359:Elane UTSW 10 79887036 missense probably damaging 1.00
R6027:Elane UTSW 10 79887018 missense probably damaging 1.00
R7565:Elane UTSW 10 79887045 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CTTCCACTGTAGCTCAATGGC -3'
(R):5'- CAAGGTTGTTACAGACCAAGGG -3'

Sequencing Primer
(F):5'- ATGGCTCCGCTACCATTAACG -3'
(R):5'- AAGGGTCCGCCAGAGTC -3'
Posted On2014-11-12