Incidental Mutation 'R2425:Tmc8'
ID250162
Institutional Source Beutler Lab
Gene Symbol Tmc8
Ensembl Gene ENSMUSG00000050106
Gene Nametransmembrane channel-like gene family 8
SynonymsEver2, EVIN2
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2425 (G1)
Quality Score216
Status Not validated
Chromosome11
Chromosomal Location117782076-117793110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117792569 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 650 (D650G)
Ref Sequence ENSEMBL: ENSMUSP00000113628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050874] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050874
AA Change: D649G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106
AA Change: D649G

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106334
AA Change: D650G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106
AA Change: D650G

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117781
AA Change: D649G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106
AA Change: D649G

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119455
AA Change: D650G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106
AA Change: D650G

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156458
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tbc1d24 A T 17: 24,186,008 V54E probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Tmc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Tmc8 APN 11 117786504 missense probably damaging 1.00
IGL01098:Tmc8 APN 11 117792563 missense possibly damaging 0.47
IGL01403:Tmc8 APN 11 117791074 missense possibly damaging 0.94
IGL01526:Tmc8 APN 11 117792084 splice site probably benign
IGL02045:Tmc8 APN 11 117786520 missense probably damaging 1.00
IGL02138:Tmc8 APN 11 117791255 missense probably benign 0.01
IGL02581:Tmc8 APN 11 117783888 missense probably benign 0.01
IGL02685:Tmc8 APN 11 117792574 missense probably damaging 0.96
R0241:Tmc8 UTSW 11 117786381 unclassified probably benign
R0485:Tmc8 UTSW 11 117792078 splice site probably benign
R1168:Tmc8 UTSW 11 117792563 missense possibly damaging 0.47
R1701:Tmc8 UTSW 11 117791362 splice site probably null
R2509:Tmc8 UTSW 11 117792685 missense possibly damaging 0.66
R4747:Tmc8 UTSW 11 117792724 missense probably benign 0.27
R4783:Tmc8 UTSW 11 117791605 splice site probably null
R5821:Tmc8 UTSW 11 117792629 nonsense probably null
R5923:Tmc8 UTSW 11 117783812 missense probably damaging 1.00
R6381:Tmc8 UTSW 11 117791600 missense probably null 0.73
R6712:Tmc8 UTSW 11 117784813 missense probably benign 0.43
R7351:Tmc8 UTSW 11 117783828 missense probably damaging 1.00
R7493:Tmc8 UTSW 11 117784932 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATGCTTCCTGGTCATAGG -3'
(R):5'- CAGAGATTGTGGGCCTAAGG -3'

Sequencing Primer
(F):5'- CCTGGTCATAGGTTAGGGGC -3'
(R):5'- TCGGTGCTACAGCTCTGTGC -3'
Posted On2014-11-12