Incidental Mutation 'R2425:Tbc1d24'
ID250174
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene NameTBC1 domain family, member 24
Synonyms
MMRRC Submission 040387-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2425 (G1)
Quality Score215
Status Not validated
Chromosome17
Chromosomal Location24175431-24209387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24186008 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 54 (V54E)
Ref Sequence ENSEMBL: ENSMUSP00000144462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000168378] [ENSMUST00000168410] [ENSMUST00000171189] [ENSMUST00000201089] [ENSMUST00000201301] [ENSMUST00000201359] [ENSMUST00000201583] [ENSMUST00000201805] [ENSMUST00000201960] [ENSMUST00000202853] [ENSMUST00000202925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040474
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097376
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167791
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168378
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126107
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168410
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171189
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128001
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201089
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201301
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201359
AA Change: V54E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000201583
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201716
Predicted Effect possibly damaging
Transcript: ENSMUST00000201805
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201960
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202018
Predicted Effect probably damaging
Transcript: ENSMUST00000202853
AA Change: V54E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000202925
AA Change: V54E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473
AA Change: V54E

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,359,810 F621S probably damaging Het
Abcc10 A G 17: 46,310,157 Y976H probably damaging Het
Abhd6 T A 14: 8,049,857 N215K probably benign Het
Adcy4 T C 14: 55,778,017 T479A probably damaging Het
Amacr A G 15: 10,983,368 Q88R possibly damaging Het
Ankrd11 T A 8: 122,893,163 I1317F possibly damaging Het
Ano3 C A 2: 110,862,843 A137S probably benign Het
Astn1 T G 1: 158,579,666 S562A probably damaging Het
Cd44 T A 2: 102,861,586 Y119F probably damaging Het
CN725425 A C 15: 91,245,855 D307A probably damaging Het
Col12a1 T C 9: 79,678,366 Y1243C probably damaging Het
Cyp2c50 T C 19: 40,089,848 I50T probably benign Het
Dhrs9 A G 2: 69,392,964 K19E probably benign Het
Dnajb14 T G 3: 137,892,905 F135V probably null Het
Draxin T A 4: 148,112,756 T195S possibly damaging Het
Elane C T 10: 79,887,776 R192C probably benign Het
Fam171a2 A C 11: 102,438,361 I524S possibly damaging Het
Fam35a A G 14: 34,268,689 S87P probably damaging Het
Fbxo10 C T 4: 45,051,642 E490K possibly damaging Het
Fkbp15 T C 4: 62,312,365 T704A probably benign Het
Fndc1 T A 17: 7,805,018 D35V probably damaging Het
Galntl5 A G 5: 25,220,081 K366E probably damaging Het
Gas7 G A 11: 67,643,295 A74T probably benign Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gldc T A 19: 30,131,790 N583Y probably damaging Het
Gpr161 T A 1: 165,310,623 S259R possibly damaging Het
Igfn1 T A 1: 135,963,102 T2387S probably damaging Het
Il3 A T 11: 54,265,549 V119D possibly damaging Het
Ints3 T C 3: 90,394,110 T822A possibly damaging Het
Jakmip1 C T 5: 37,141,805 Q790* probably null Het
Kcne1 A G 16: 92,348,758 I66T probably damaging Het
Nipbl A G 15: 8,351,482 S609P probably benign Het
Olfr1053 A G 2: 86,314,395 V297A probably damaging Het
Olfr330 A G 11: 58,529,311 I225T probably damaging Het
Olfr975 T C 9: 39,949,841 E310G probably null Het
Pdxdc1 A T 16: 13,879,508 S103T possibly damaging Het
Pla2g2a C A 4: 138,832,918 A24E possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pramel1 T G 4: 143,398,466 L320R probably damaging Het
Rad23b T A 4: 55,385,438 I325N probably damaging Het
Rasgrp1 C G 2: 117,289,450 probably null Het
Rbm12b1 T A 4: 12,146,443 I805N probably damaging Het
Slc12a9 G T 5: 137,315,597 A700E probably damaging Het
Tmc8 A G 11: 117,792,569 D650G probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Ush2a T A 1: 188,537,804 N1749K possibly damaging Het
Usp42 T C 5: 143,715,839 T810A probably benign Het
Wdr70 C A 15: 7,887,359 E526* probably null Het
Zfp935 G T 13: 62,455,108 Q93K probably benign Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24185828 missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24181918 missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24207619 unclassified probably null
IGL02706:Tbc1d24 APN 17 24185421 missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1529:Tbc1d24 UTSW 17 24185979 missense probably damaging 1.00
R1985:Tbc1d24 UTSW 17 24207964 nonsense probably null
R1987:Tbc1d24 UTSW 17 24206872 missense possibly damaging 0.94
R2902:Tbc1d24 UTSW 17 24207246 missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24208891 missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24208536 missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24181772 missense probably benign 0.34
R5890:Tbc1d24 UTSW 17 24185526 missense probably damaging 1.00
R5991:Tbc1d24 UTSW 17 24209069 unclassified probably benign
R6002:Tbc1d24 UTSW 17 24183787 start codon destroyed probably null 1.00
R6145:Tbc1d24 UTSW 17 24208229 missense probably damaging 1.00
R6245:Tbc1d24 UTSW 17 24185993 missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24208329 missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24185780 missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24182518 missense probably damaging 1.00
R7219:Tbc1d24 UTSW 17 24185292 missense probably damaging 1.00
R7262:Tbc1d24 UTSW 17 24207846 missense probably damaging 1.00
R7490:Tbc1d24 UTSW 17 24182520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAGGAGGATCTTGCGC -3'
(R):5'- TCAATCCTACAGGGTGTGTGG -3'

Sequencing Primer
(F):5'- GCGCACAGCCCCTTCAC -3'
(R):5'- TGTGGGATGACAGACTGGTTAAC -3'
Posted On2014-11-12