Incidental Mutation 'R2426:Serping1'
ID 250192
Institutional Source Beutler Lab
Gene Symbol Serping1
Ensembl Gene ENSMUSG00000023224
Gene Name serine (or cysteine) peptidase inhibitor, clade G, member 1
Synonyms C1INH, C1 inhibitor, C1nh
MMRRC Submission 040388-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R2426 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 84765387-84775444 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 84770219 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 260 (S260R)
Ref Sequence ENSEMBL: ENSMUSP00000107268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023994] [ENSMUST00000111641]
AlphaFold P97290
Predicted Effect probably damaging
Transcript: ENSMUST00000023994
AA Change: S260R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023994
Gene: ENSMUSG00000023224
AA Change: S260R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 502 3.26e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111641
AA Change: S260R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107268
Gene: ENSMUSG00000023224
AA Change: S260R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SERPIN 156 347 5.39e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131456
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its protein inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. Deficiency of this protein is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit an increased vascular permeability compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G T 7: 120,283,223 (GRCm38) V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 (GRCm38) V131I probably benign Het
Adgra3 A T 5: 50,009,449 (GRCm38) M187K possibly damaging Het
Agbl1 T C 7: 76,421,902 (GRCm38) V324A probably damaging Het
Ahnak A T 19: 9,002,851 (GRCm38) I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 (GRCm38) D851G probably damaging Het
Amot T C X: 145,476,291 (GRCm38) K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 (GRCm38) E161* probably null Het
Atg9b A T 5: 24,386,994 (GRCm38) I669N probably damaging Het
Ccdc83 A G 7: 90,228,431 (GRCm38) Y268H probably damaging Het
Cep170 A G 1: 176,774,635 (GRCm38) S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 (GRCm38) M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 (GRCm38) Y231F probably benign Het
Defa39 T G 8: 21,702,637 (GRCm38) K114N possibly damaging Het
Dock3 A T 9: 106,914,541 (GRCm38) L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 (GRCm38) I629N probably damaging Het
Dst A T 1: 34,192,812 (GRCm38) H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 (GRCm38) P343L probably benign Het
Fbrs A G 7: 127,487,339 (GRCm38) probably null Het
Fbxl13 A C 5: 21,522,137 (GRCm38) D620E probably damaging Het
Frmd4a T A 2: 4,529,862 (GRCm38) S164T probably damaging Het
Gdi2 T G 13: 3,562,034 (GRCm38) S330A probably benign Het
Gm5878 A T 6: 85,118,631 (GRCm38) M70K probably benign Het
H2-Q6 G T 17: 35,424,937 (GRCm38) A21S probably benign Het
Hfm1 A T 5: 106,847,653 (GRCm38) probably null Het
Hnmt C T 2: 24,019,155 (GRCm38) C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 (GRCm38) A310D probably damaging Het
Ints1 A T 5: 139,771,814 (GRCm38) probably null Het
Kcne4 C A 1: 78,817,971 (GRCm38) A112E possibly damaging Het
Krt32 T C 11: 100,086,366 (GRCm38) K236R possibly damaging Het
Maml2 T C 9: 13,706,498 (GRCm38) L380P probably damaging Het
Meis1 A T 11: 18,988,356 (GRCm38) D218E possibly damaging Het
Mon1b G A 8: 113,639,120 (GRCm38) G360D probably damaging Het
Mpp4 A G 1: 59,130,057 (GRCm38) S383P probably damaging Het
Neb A G 2: 52,169,053 (GRCm38) probably null Het
Nlgn2 A T 11: 69,827,086 (GRCm38) I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 (GRCm38) L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 (GRCm38) Y127* probably null Het
Opcml G A 9: 28,903,367 (GRCm38) probably null Het
Or6c207 T C 10: 129,269,266 (GRCm38) Q19R probably benign Het
Or7c19 T C 8: 85,231,064 (GRCm38) S190P probably damaging Het
Pate2 A T 9: 35,670,480 (GRCm38) probably null Het
Pgr G A 9: 8,900,717 (GRCm38) V84M probably damaging Het
Pigu A T 2: 155,299,082 (GRCm38) V296D probably damaging Het
Plcb2 G A 2: 118,715,649 (GRCm38) T555M probably damaging Het
Pld5 T G 1: 175,963,976 (GRCm38) D426A probably benign Het
Prdm2 G T 4: 143,111,750 (GRCm38) C1679* probably null Het
Psme2b A T 11: 48,946,063 (GRCm38) V19D probably benign Het
Ptpn9 A T 9: 57,027,428 (GRCm38) N159Y possibly damaging Het
Sanbr T A 11: 23,576,801 (GRCm38) R190W probably damaging Het
Sdc3 A T 4: 130,818,803 (GRCm38) T64S unknown Het
Slc20a1 T C 2: 129,208,230 (GRCm38) F436S probably benign Het
Sntb1 A T 15: 55,906,179 (GRCm38) I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 (GRCm38) Y643F probably damaging Het
Spink1 G T 18: 43,735,222 (GRCm38) S23* probably null Het
Stag1 T C 9: 100,845,116 (GRCm38) probably null Het
Tnfaip8l1 G A 17: 56,172,030 (GRCm38) V107I probably benign Het
Tnik A G 3: 28,646,681 (GRCm38) S907G probably damaging Het
Ttf1 T A 2: 29,067,185 (GRCm38) M489K probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm38) P46S probably benign Het
Usp54 G A 14: 20,564,940 (GRCm38) A811V probably benign Het
Xirp2 A G 2: 67,514,471 (GRCm38) N2352S probably benign Het
Zan T C 5: 137,388,992 (GRCm38) Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 (GRCm38) S161P probably benign Het
Zkscan5 A T 5: 145,220,940 (GRCm38) I751L probably benign Het
Zscan4d A G 7: 11,165,095 (GRCm38) F85S probably damaging Het
Zzef1 A G 11: 72,915,265 (GRCm38) M2647V probably benign Het
Other mutations in Serping1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Serping1 APN 2 84,770,185 (GRCm38) missense probably damaging 1.00
IGL01791:Serping1 APN 2 84,773,377 (GRCm38) missense possibly damaging 0.68
IGL01903:Serping1 APN 2 84,769,772 (GRCm38) critical splice donor site probably null
IGL03182:Serping1 APN 2 84,765,818 (GRCm38) missense probably damaging 1.00
R0094:Serping1 UTSW 2 84,773,276 (GRCm38) missense probably benign 0.00
R0548:Serping1 UTSW 2 84,770,081 (GRCm38) splice site probably benign
R0782:Serping1 UTSW 2 84,767,446 (GRCm38) missense probably damaging 1.00
R1585:Serping1 UTSW 2 84,771,504 (GRCm38) missense probably benign 0.33
R1900:Serping1 UTSW 2 84,771,449 (GRCm38) missense probably damaging 0.99
R1965:Serping1 UTSW 2 84,765,728 (GRCm38) missense probably damaging 1.00
R1966:Serping1 UTSW 2 84,765,728 (GRCm38) missense probably damaging 1.00
R2252:Serping1 UTSW 2 84,769,851 (GRCm38) missense probably damaging 0.99
R4997:Serping1 UTSW 2 84,770,285 (GRCm38) missense possibly damaging 0.74
R5665:Serping1 UTSW 2 84,771,545 (GRCm38) missense probably damaging 0.99
R6192:Serping1 UTSW 2 84,770,268 (GRCm38) missense possibly damaging 0.93
R6866:Serping1 UTSW 2 84,770,233 (GRCm38) missense probably benign 0.42
R7084:Serping1 UTSW 2 84,773,491 (GRCm38) missense probably benign
R7526:Serping1 UTSW 2 84,767,293 (GRCm38) missense probably benign
R7707:Serping1 UTSW 2 84,773,699 (GRCm38) splice site probably null
R7732:Serping1 UTSW 2 84,770,104 (GRCm38) missense probably damaging 1.00
R9480:Serping1 UTSW 2 84,770,143 (GRCm38) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACATGGGAATGTGTCTGTGGAAC -3'
(R):5'- AGAACCTATGGGAAGTGTGC -3'

Sequencing Primer
(F):5'- TGGAACTCTGAGCCTGGAGAC -3'
(R):5'- AACCTATGGGAAGTGTGCTCTCTC -3'
Posted On 2014-11-12