Mutagenetix > Incidental Mutations

Incidental Mutation 'R2426:Tnik'

250196

Institutional Source

Beutler Lab

Gene Symbol

Tnik

Ensembl Gene

ENSMUSG00000027692

Gene Name

TRAF2 and NCK interacting kinase

Synonyms

C630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik

MMRRC Submission

040388-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28263214-28675858 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28646681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 907 (S907G)

Ref Sequence

ENSEMBL: ENSMUSP00000124011 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]

AlphaFold

P83510

Predicted Effect

probably damaging
Transcript: ENSMUST00000159236
AA Change: S899G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: S899G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	951	958	N/A	INTRINSIC
CNH	1005	1303	1.92e-117	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159308
AA Change: S852G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: S852G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	746	765	N/A	INTRINSIC
low complexity region	904	911	N/A	INTRINSIC
CNH	958	1256	1.92e-117	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000159680
AA Change: S928G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: S928G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	980	987	N/A	INTRINSIC
CNH	1034	1332	1.92e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159733

Predicted Effect

probably damaging
Transcript: ENSMUST00000160307
AA Change: S936G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: S936G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	720	755	N/A	INTRINSIC
low complexity region	830	849	N/A	INTRINSIC
low complexity region	988	995	N/A	INTRINSIC
CNH	1042	1340	1.92e-117	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160518
AA Change: S907G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: S907G

Domain	Start	End	E-Value	Type
S_TKc	25	289	5.9e-99	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	691	726	N/A	INTRINSIC
low complexity region	801	820	N/A	INTRINSIC
low complexity region	959	966	N/A	INTRINSIC
CNH	1013	1311	9.3e-120	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160934

SMART Domains

Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	25	212	2.2e-37	PFAM
Pfam:Pkinase	25	219	5.9e-52	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000161964
AA Change: S844G

SMART Domains

Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: S844G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	482	N/A	INTRINSIC
low complexity region	636	671	N/A	INTRINSIC
low complexity region	738	757	N/A	INTRINSIC
low complexity region	896	903	N/A	INTRINSIC
CNH	950	1248	1.92e-117	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162037

Predicted Effect

probably damaging
Transcript: ENSMUST00000162485
AA Change: S881G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: S881G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	775	794	N/A	INTRINSIC
low complexity region	933	940	N/A	INTRINSIC
CNH	987	1285	1.92e-117	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000162777
AA Change: S873G

SMART Domains

Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: S873G

Domain	Start	End	E-Value	Type
S_TKc	25	289	1.23e-96	SMART
low complexity region	317	340	N/A	INTRINSIC
coiled coil region	360	511	N/A	INTRINSIC
low complexity region	665	700	N/A	INTRINSIC
low complexity region	767	786	N/A	INTRINSIC
low complexity region	925	932	N/A	INTRINSIC
CNH	979	1277	1.92e-117	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Arhgef3	G	T	14: 27,384,181	E161*	probably null	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Nr2e1	A	G	10: 42,563,485	L134P	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Prdm2	G	T	4: 143,111,750	C1679*	probably null	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Tnik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Tnik	APN	3	28654218	missense	probably damaging	1.00
IGL00726:Tnik	APN	3	28532898	missense	probably damaging	1.00
IGL01022:Tnik	APN	3	28625228	splice site	probably null
IGL01145:Tnik	APN	3	28604167	intron	probably benign
IGL01664:Tnik	APN	3	28638479	missense	probably damaging	1.00
IGL01843:Tnik	APN	3	28570858	splice site	probably null
IGL02378:Tnik	APN	3	28638459	nonsense	probably null
IGL02448:Tnik	APN	3	28621077	missense	probably null	0.01
IGL02756:Tnik	APN	3	28542030	missense	probably damaging	1.00
IGL03332:Tnik	APN	3	28666155	missense	probably damaging	1.00
delightful	UTSW	3	28604185	missense	probably damaging	1.00
Hottie	UTSW	3	28263643	start codon destroyed	probably null	0.93
Knockout	UTSW	3	28661778	missense	possibly damaging	0.91
Looker	UTSW	3	28661704	nonsense	probably null
Lovely	UTSW	3	28611970	critical splice donor site	probably null
Usher	UTSW	3	28564097	missense	possibly damaging	0.61
R0135:Tnik	UTSW	3	28607245	missense	possibly damaging	0.67
R0418:Tnik	UTSW	3	28570880	nonsense	probably null
R0540:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0549:Tnik	UTSW	3	28570920	missense	possibly damaging	0.87
R0556:Tnik	UTSW	3	28625218	missense	possibly damaging	0.95
R0586:Tnik	UTSW	3	28577361	splice site	probably benign
R0607:Tnik	UTSW	3	28650159	missense	probably damaging	1.00
R0842:Tnik	UTSW	3	28594086	missense	possibly damaging	0.72
R1068:Tnik	UTSW	3	28532975	missense	probably damaging	1.00
R1171:Tnik	UTSW	3	28532940	missense	probably damaging	1.00
R1597:Tnik	UTSW	3	28604269	missense	probably damaging	1.00
R1638:Tnik	UTSW	3	28665740	missense	probably damaging	0.99
R1652:Tnik	UTSW	3	28604293	missense	probably benign	0.22
R1996:Tnik	UTSW	3	28665680	missense	probably damaging	1.00
R2333:Tnik	UTSW	3	28532996	missense	probably damaging	1.00
R2509:Tnik	UTSW	3	28667915	missense	probably damaging	1.00
R3774:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R3775:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R4007:Tnik	UTSW	3	28604281	missense	probably damaging	1.00
R4119:Tnik	UTSW	3	28666175	missense	probably damaging	1.00
R4209:Tnik	UTSW	3	28359065	splice site	probably benign
R4441:Tnik	UTSW	3	28564097	missense	possibly damaging	0.61
R4611:Tnik	UTSW	3	28542100	critical splice donor site	probably null
R4714:Tnik	UTSW	3	28594077	missense	possibly damaging	0.53
R4772:Tnik	UTSW	3	28607210	missense	probably benign	0.09
R4829:Tnik	UTSW	3	28539541	intron	probably benign
R4839:Tnik	UTSW	3	28596075	missense	possibly damaging	0.86
R4898:Tnik	UTSW	3	28650086	missense	probably damaging	1.00
R5029:Tnik	UTSW	3	28665844	splice site	probably null
R5278:Tnik	UTSW	3	28650060	missense	probably damaging	1.00
R5307:Tnik	UTSW	3	28541972	missense	probably damaging	1.00
R5330:Tnik	UTSW	3	28542018	missense	probably damaging	1.00
R5375:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5459:Tnik	UTSW	3	28661741	missense	probably damaging	1.00
R5708:Tnik	UTSW	3	28611971	critical splice donor site	probably null
R5749:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5751:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5780:Tnik	UTSW	3	28594092	missense	probably benign	0.02
R5837:Tnik	UTSW	3	28668053	unclassified	probably benign
R5969:Tnik	UTSW	3	28620948	missense	probably damaging	1.00
R6244:Tnik	UTSW	3	28650179	missense	probably damaging	1.00
R6273:Tnik	UTSW	3	28577500	missense	possibly damaging	0.94
R6457:Tnik	UTSW	3	28539448	missense	probably damaging	1.00
R6464:Tnik	UTSW	3	28611970	critical splice donor site	probably null
R6473:Tnik	UTSW	3	28263643	start codon destroyed	probably null	0.93
R6737:Tnik	UTSW	3	28596086	missense	possibly damaging	0.72
R7049:Tnik	UTSW	3	28661704	nonsense	probably null
R7237:Tnik	UTSW	3	28638419	missense	probably damaging	0.98
R7267:Tnik	UTSW	3	28646627	missense	probably damaging	0.99
R7445:Tnik	UTSW	3	28663909	splice site	probably null
R7499:Tnik	UTSW	3	28630594	missense	possibly damaging	0.47
R7629:Tnik	UTSW	3	28661728	missense	probably damaging	0.96
R7654:Tnik	UTSW	3	28604185	missense	probably damaging	1.00
R7886:Tnik	UTSW	3	28666139	missense	probably damaging	1.00
R8096:Tnik	UTSW	3	28661778	missense	possibly damaging	0.91
R8210:Tnik	UTSW	3	28604333	missense	possibly damaging	0.95
R8233:Tnik	UTSW	3	28554937	missense	unknown
R8386:Tnik	UTSW	3	28263674	missense	unknown
R8399:Tnik	UTSW	3	28494010	missense	unknown
R8490:Tnik	UTSW	3	28596172	missense	probably damaging	0.97
R8539:Tnik	UTSW	3	28542003	missense	probably damaging	1.00
R8751:Tnik	UTSW	3	28611908	missense	probably damaging	0.98
R8804:Tnik	UTSW	3	28594053	missense	unknown
R8966:Tnik	UTSW	3	28532895	missense	unknown
R8998:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R8999:Tnik	UTSW	3	28665771	missense	probably damaging	1.00
R9016:Tnik	UTSW	3	28638395	missense	probably damaging	1.00
R9154:Tnik	UTSW	3	28650086	missense	probably damaging	0.99
R9284:Tnik	UTSW	3	28539421	missense	unknown
R9290:Tnik	UTSW	3	28620975	missense	probably benign	0.00
R9411:Tnik	UTSW	3	28630605	missense	probably damaging	1.00
X0022:Tnik	UTSW	3	28667951	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28604324	missense	probably damaging	1.00
Z1176:Tnik	UTSW	3	28607328	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GTGAGGTATTGATCTAGGTACCATC -3'
(R):5'- GTTCAGAGAGTCTGGCAAAGC -3'

Sequencing Primer
(F):5'- GGTACCATCTTAGACTCCCTGGAAG -3'
(R):5'- GGCAAAGCCTGATTGTTTAAGTC -3'

Posted On

2014-11-12