Mutagenetix > Incidental Mutations

Incidental Mutation 'R2426:Prdm2'

250204

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

040388-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 143111750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1679 (C1679*)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably null
Transcript: ENSMUST00000105778
AA Change: C1679*

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: C1679*

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Adgra3	A	T	5: 50,009,449	M187K	possibly damaging	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Arhgef3	G	T	14: 27,384,181	E161*	probably null	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Nr2e1	A	G	10: 42,563,485	L134P	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Tnik	A	G	3: 28,646,681	S907G	probably damaging	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACCCAAGATGTACCTGGACC -3'
(R):5'- CCCTGGACTGACATTTCCATTAGG -3'

Sequencing Primer
(F):5'- GATGTACCTGGACCCCACC -3'
(R):5'- CCATTAGGAAGTTCTGTCACCC -3'

Posted On

2014-11-12