Mutagenetix > Incidental Mutation

Incidental Mutation 'R2426:Adgra3'

250207

Institutional Source

Beutler Lab

Gene Symbol

Adgra3

Ensembl Gene

ENSMUSG00000029090

Gene Name

adhesion G protein-coupled receptor A3

Synonyms

Gpr125, Tem5-like, 3830613O22Rik

MMRRC Submission

040388-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49959956-50059006 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50009449 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 187 (M187K)

Ref Sequence

ENSEMBL: ENSMUSP00000030971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030971]

AlphaFold

Q7TT36

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030971
AA Change: M187K

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: M187K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	36	48	N/A	INTRINSIC
LRR	68	92	1.71e1	SMART
LRR_TYP	93	116	2.27e-4	SMART
LRR_TYP	117	140	4.11e-2	SMART
LRR_TYP	141	164	3.89e-3	SMART
LRRCT	176	225	5.24e-5	SMART
IG	238	331	8.26e-5	SMART
GPS	686	738	4.81e-3	SMART
Pfam:7tm_2	746	1031	1.6e-16	PFAM
low complexity region	1251	1262	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196229

Meta Mutation Damage Score

0.2527

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	T	A	11: 23,576,801	R190W	probably damaging	Het
Abca14	G	T	7: 120,283,223	V1203L	probably benign	Het
Adamtsl1	G	A	4: 86,156,788	V131I	probably benign	Het
Agbl1	T	C	7: 76,421,902	V324A	probably damaging	Het
Ahnak	A	T	19: 9,002,851	I500F	possibly damaging	Het
Aldh1l1	A	G	6: 90,598,284	D851G	probably damaging	Het
Amot	T	C	X: 145,476,291	K460E	probably damaging	Het
Arhgef3	G	T	14: 27,384,181	E161*	probably null	Het
Atg9b	A	T	5: 24,386,994	I669N	probably damaging	Het
AY761184	T	G	8: 21,702,637	K114N	possibly damaging	Het
Ccdc83	A	G	7: 90,228,431	Y268H	probably damaging	Het
Cep170	A	G	1: 176,774,635	S302P	probably benign	Het
Cyp4a31	T	A	4: 115,571,016	M303K	probably damaging	Het
Cyp4v3	T	A	8: 45,317,776	Y231F	probably benign	Het
Dock3	A	T	9: 106,914,541	L1411Q	possibly damaging	Het
Dsg1a	T	A	18: 20,336,804	I629N	probably damaging	Het
Dst	A	T	1: 34,192,812	H2837L	probably benign	Het
Fam114a2	G	A	11: 57,493,080	P343L	probably benign	Het
Fbrs	A	G	7: 127,487,339		probably null	Het
Fbxl13	A	C	5: 21,522,137	D620E	probably damaging	Het
Frmd4a	T	A	2: 4,529,862	S164T	probably damaging	Het
Gdi2	T	G	13: 3,562,034	S330A	probably benign	Het
Gm5878	A	T	6: 85,118,631	M70K	probably benign	Het
H2-Q6	G	T	17: 35,424,937	A21S	probably benign	Het
Hfm1	A	T	5: 106,847,653		probably null	Het
Hnmt	C	T	2: 24,019,155	C82Y	probably benign	Het
Il1rl1	C	A	1: 40,446,619	A310D	probably damaging	Het
Ints1	A	T	5: 139,771,814		probably null	Het
Kcne4	C	A	1: 78,817,971	A112E	possibly damaging	Het
Krt32	T	C	11: 100,086,366	K236R	possibly damaging	Het
Maml2	T	C	9: 13,706,498	L380P	probably damaging	Het
Meis1	A	T	11: 18,988,356	D218E	possibly damaging	Het
Mon1b	G	A	8: 113,639,120	G360D	probably damaging	Het
Mpp4	A	G	1: 59,130,057	S383P	probably damaging	Het
Neb	A	G	2: 52,169,053		probably null	Het
Nlgn2	A	T	11: 69,827,086	I431N	probably damaging	Het
Nr2e1	A	G	10: 42,563,485	L134P	probably damaging	Het
Olfr329-ps	A	T	11: 58,543,094	Y127*	probably null	Het
Olfr371	T	C	8: 85,231,064	S190P	probably damaging	Het
Olfr777	T	C	10: 129,269,266	Q19R	probably benign	Het
Opcml	G	A	9: 28,903,367		probably null	Het
Pate2	A	T	9: 35,670,480		probably null	Het
Pgr	G	A	9: 8,900,717	V84M	probably damaging	Het
Pigu	A	T	2: 155,299,082	V296D	probably damaging	Het
Plcb2	G	A	2: 118,715,649	T555M	probably damaging	Het
Pld5	T	G	1: 175,963,976	D426A	probably benign	Het
Prdm2	G	T	4: 143,111,750	C1679*	probably null	Het
Psme2b	A	T	11: 48,946,063	V19D	probably benign	Het
Ptpn9	A	T	9: 57,027,428	N159Y	possibly damaging	Het
Sdc3	A	T	4: 130,818,803	T64S	unknown	Het
Serping1	T	G	2: 84,770,219	S260R	probably damaging	Het
Slc20a1	T	C	2: 129,208,230	F436S	probably benign	Het
Sntb1	A	T	15: 55,906,179	I138N	probably damaging	Het
Sorcs3	A	T	19: 48,722,925	Y643F	probably damaging	Het
Spink1	G	T	18: 43,735,222	S23*	probably null	Het
Stag1	T	C	9: 100,845,116		probably null	Het
Tnfaip8l1	G	A	17: 56,172,030	V107I	probably benign	Het
Tnik	A	G	3: 28,646,681	S907G	probably damaging	Het
Ttf1	T	A	2: 29,067,185	M489K	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp54	G	A	14: 20,564,940	A811V	probably benign	Het
Xirp2	A	G	2: 67,514,471	N2352S	probably benign	Het
Zan	T	C	5: 137,388,992	Y4933C	unknown	Het
Zbtb8a	A	G	4: 129,360,219	S161P	probably benign	Het
Zkscan5	A	T	5: 145,220,940	I751L	probably benign	Het
Zscan4d	A	G	7: 11,165,095	F85S	probably damaging	Het
Zzef1	A	G	11: 72,915,265	M2647V	probably benign	Het

Other mutations in Adgra3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00777:Adgra3	APN	5	50025758	missense	probably damaging	1.00
IGL00848:Adgra3	APN	5	50001949	missense	probably damaging	1.00
IGL01455:Adgra3	APN	5	49987557	nonsense	probably null
IGL01665:Adgra3	APN	5	50006930	missense	possibly damaging	0.64
IGL02151:Adgra3	APN	5	49979142	missense	probably benign
IGL02239:Adgra3	APN	5	49960712	missense	probably damaging	1.00
IGL02351:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02358:Adgra3	APN	5	50058558	missense	probably benign	0.19
IGL02938:Adgra3	APN	5	49961317	missense	probably benign	0.01
IGL03028:Adgra3	APN	5	50016852	missense	probably benign	0.30
aperture	UTSW	5	49999145	nonsense	probably null
saltatory	UTSW	5	49960559	missense	probably benign	0.09
ANU74:Adgra3	UTSW	5	49961038	missense	probably benign	0.16
R0041:Adgra3	UTSW	5	49960559	missense	probably benign	0.09
R0121:Adgra3	UTSW	5	50025786	splice site	probably benign
R0125:Adgra3	UTSW	5	50001852	splice site	probably benign
R0137:Adgra3	UTSW	5	49963840	splice site	probably benign
R0415:Adgra3	UTSW	5	49961757	splice site	probably benign
R0479:Adgra3	UTSW	5	49990265	missense	probably benign	0.00
R0505:Adgra3	UTSW	5	50009334	critical splice donor site	probably null
R0831:Adgra3	UTSW	5	49970802	missense	probably damaging	1.00
R0883:Adgra3	UTSW	5	49960723	missense	probably damaging	1.00
R0920:Adgra3	UTSW	5	49961161	missense	probably benign	0.19
R1139:Adgra3	UTSW	5	49961755	splice site	probably null
R1211:Adgra3	UTSW	5	50006876	missense	possibly damaging	0.88
R1370:Adgra3	UTSW	5	49960787	missense	possibly damaging	0.56
R1530:Adgra3	UTSW	5	49961137	missense	probably benign	0.00
R1703:Adgra3	UTSW	5	50006775	missense	probably benign	0.00
R1782:Adgra3	UTSW	5	49972062	missense	probably benign	0.02
R1843:Adgra3	UTSW	5	49961492	missense	probably damaging	1.00
R2157:Adgra3	UTSW	5	50001941	missense	possibly damaging	0.87
R2281:Adgra3	UTSW	5	50001880	missense	probably benign	0.04
R2385:Adgra3	UTSW	5	49979566	missense	possibly damaging	0.95
R3084:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3086:Adgra3	UTSW	5	50013391	critical splice donor site	probably null
R3409:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3410:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R3411:Adgra3	UTSW	5	50001930	missense	probably damaging	1.00
R4301:Adgra3	UTSW	5	49961078	missense	possibly damaging	0.94
R4360:Adgra3	UTSW	5	49990210	missense	possibly damaging	0.92
R4475:Adgra3	UTSW	5	50001898	missense	probably damaging	1.00
R4569:Adgra3	UTSW	5	49960563	missense	probably damaging	1.00
R4607:Adgra3	UTSW	5	49970739	missense	probably damaging	0.98
R4667:Adgra3	UTSW	5	49978956	missense	possibly damaging	0.94
R4671:Adgra3	UTSW	5	49979368	missense	probably damaging	1.00
R4886:Adgra3	UTSW	5	49999195	missense	probably benign	0.07
R5197:Adgra3	UTSW	5	49960754	missense	probably benign	0.01
R5208:Adgra3	UTSW	5	50011515	missense	probably damaging	0.99
R5313:Adgra3	UTSW	5	49961309	missense	probably benign	0.24
R5435:Adgra3	UTSW	5	49990126	missense	probably damaging	0.99
R5663:Adgra3	UTSW	5	49999285	missense	probably benign	0.14
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6038:Adgra3	UTSW	5	49999145	nonsense	probably null
R6064:Adgra3	UTSW	5	49960325	missense	probably damaging	0.97
R6259:Adgra3	UTSW	5	49999141	missense	possibly damaging	0.63
R6272:Adgra3	UTSW	5	50009449	missense	possibly damaging	0.61
R6293:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6296:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6297:Adgra3	UTSW	5	49960847	missense	probably benign	0.21
R6352:Adgra3	UTSW	5	49979136	missense	probably benign
R6352:Adgra3	UTSW	5	49990250	missense	probably benign	0.01
R6989:Adgra3	UTSW	5	50006884	missense	probably damaging	1.00
R7026:Adgra3	UTSW	5	49960741	missense	probably benign
R7147:Adgra3	UTSW	5	49961245	missense	probably damaging	1.00
R7206:Adgra3	UTSW	5	50006896	missense	probably damaging	1.00
R7381:Adgra3	UTSW	5	50058774	start codon destroyed	probably null
R7508:Adgra3	UTSW	5	50016867	missense	probably benign	0.10
R7538:Adgra3	UTSW	5	49961450	missense	probably benign	0.01
R7579:Adgra3	UTSW	5	49987635	missense	probably benign
R7951:Adgra3	UTSW	5	49963784	missense	probably damaging	1.00
R8269:Adgra3	UTSW	5	49963737	missense	probably damaging	0.98
R8458:Adgra3	UTSW	5	49987671	missense	probably damaging	0.99
R8486:Adgra3	UTSW	5	49990279	missense	probably damaging	0.98
R8912:Adgra3	UTSW	5	49960931	missense	possibly damaging	0.61
R8955:Adgra3	UTSW	5	49961389	missense	probably benign	0.05
R9108:Adgra3	UTSW	5	49978953	missense	probably damaging	1.00
R9112:Adgra3	UTSW	5	49961053	missense	probably damaging	1.00
R9191:Adgra3	UTSW	5	49987664	missense	possibly damaging	0.88
R9267:Adgra3	UTSW	5	49998276	missense	possibly damaging	0.87
R9312:Adgra3	UTSW	5	49960558	missense	probably damaging	1.00
R9537:Adgra3	UTSW	5	49960865	missense	possibly damaging	0.82
R9614:Adgra3	UTSW	5	50006908	missense	probably damaging	1.00
RF005:Adgra3	UTSW	5	50013387	splice site	probably null
RF024:Adgra3	UTSW	5	50013387	splice site	probably null
RF036:Adgra3	UTSW	5	50058641	small deletion	probably benign
X0065:Adgra3	UTSW	5	49971962	missense	probably benign
Z1187:Adgra3	UTSW	5	49979079	missense	probably damaging	1.00
Z1192:Adgra3	UTSW	5	49999281	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCCAGATTAACTGTGCCGAG -3'
(R):5'- AGGACTAACCAGTTTACGATCCAC -3'

Sequencing Primer
(F):5'- CCAGATTAACTGTGCCGAGATTCTG -3'
(R):5'- CACCTTGTGCTTTACAACAAAAAGG -3'

Posted On

2014-11-12