Incidental Mutation 'R2426:Adgra3'
ID250207
Institutional Source Beutler Lab
Gene Symbol Adgra3
Ensembl Gene ENSMUSG00000029090
Gene Nameadhesion G protein-coupled receptor A3
SynonymsGpr125, Tem5-like, 3830613O22Rik
MMRRC Submission 040388-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2426 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location49959956-50059006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50009449 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 187 (M187K)
Ref Sequence ENSEMBL: ENSMUSP00000030971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030971
AA Change: M187K

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030971
Gene: ENSMUSG00000029090
AA Change: M187K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 36 48 N/A INTRINSIC
LRR 68 92 1.71e1 SMART
LRR_TYP 93 116 2.27e-4 SMART
LRR_TYP 117 140 4.11e-2 SMART
LRR_TYP 141 164 3.89e-3 SMART
LRRCT 176 225 5.24e-5 SMART
IG 238 331 8.26e-5 SMART
GPS 686 738 4.81e-3 SMART
Pfam:7tm_2 746 1031 1.6e-16 PFAM
low complexity region 1251 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196229
Meta Mutation Damage Score 0.2527 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous mutant mice are fertile and grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T A 11: 23,576,801 R190W probably damaging Het
Abca14 G T 7: 120,283,223 V1203L probably benign Het
Adamtsl1 G A 4: 86,156,788 V131I probably benign Het
Agbl1 T C 7: 76,421,902 V324A probably damaging Het
Ahnak A T 19: 9,002,851 I500F possibly damaging Het
Aldh1l1 A G 6: 90,598,284 D851G probably damaging Het
Amot T C X: 145,476,291 K460E probably damaging Het
Arhgef3 G T 14: 27,384,181 E161* probably null Het
Atg9b A T 5: 24,386,994 I669N probably damaging Het
AY761184 T G 8: 21,702,637 K114N possibly damaging Het
Ccdc83 A G 7: 90,228,431 Y268H probably damaging Het
Cep170 A G 1: 176,774,635 S302P probably benign Het
Cyp4a31 T A 4: 115,571,016 M303K probably damaging Het
Cyp4v3 T A 8: 45,317,776 Y231F probably benign Het
Dock3 A T 9: 106,914,541 L1411Q possibly damaging Het
Dsg1a T A 18: 20,336,804 I629N probably damaging Het
Dst A T 1: 34,192,812 H2837L probably benign Het
Fam114a2 G A 11: 57,493,080 P343L probably benign Het
Fbrs A G 7: 127,487,339 probably null Het
Fbxl13 A C 5: 21,522,137 D620E probably damaging Het
Frmd4a T A 2: 4,529,862 S164T probably damaging Het
Gdi2 T G 13: 3,562,034 S330A probably benign Het
Gm5878 A T 6: 85,118,631 M70K probably benign Het
H2-Q6 G T 17: 35,424,937 A21S probably benign Het
Hfm1 A T 5: 106,847,653 probably null Het
Hnmt C T 2: 24,019,155 C82Y probably benign Het
Il1rl1 C A 1: 40,446,619 A310D probably damaging Het
Ints1 A T 5: 139,771,814 probably null Het
Kcne4 C A 1: 78,817,971 A112E possibly damaging Het
Krt32 T C 11: 100,086,366 K236R possibly damaging Het
Maml2 T C 9: 13,706,498 L380P probably damaging Het
Meis1 A T 11: 18,988,356 D218E possibly damaging Het
Mon1b G A 8: 113,639,120 G360D probably damaging Het
Mpp4 A G 1: 59,130,057 S383P probably damaging Het
Neb A G 2: 52,169,053 probably null Het
Nlgn2 A T 11: 69,827,086 I431N probably damaging Het
Nr2e1 A G 10: 42,563,485 L134P probably damaging Het
Olfr329-ps A T 11: 58,543,094 Y127* probably null Het
Olfr371 T C 8: 85,231,064 S190P probably damaging Het
Olfr777 T C 10: 129,269,266 Q19R probably benign Het
Opcml G A 9: 28,903,367 probably null Het
Pate2 A T 9: 35,670,480 probably null Het
Pgr G A 9: 8,900,717 V84M probably damaging Het
Pigu A T 2: 155,299,082 V296D probably damaging Het
Plcb2 G A 2: 118,715,649 T555M probably damaging Het
Pld5 T G 1: 175,963,976 D426A probably benign Het
Prdm2 G T 4: 143,111,750 C1679* probably null Het
Psme2b A T 11: 48,946,063 V19D probably benign Het
Ptpn9 A T 9: 57,027,428 N159Y possibly damaging Het
Sdc3 A T 4: 130,818,803 T64S unknown Het
Serping1 T G 2: 84,770,219 S260R probably damaging Het
Slc20a1 T C 2: 129,208,230 F436S probably benign Het
Sntb1 A T 15: 55,906,179 I138N probably damaging Het
Sorcs3 A T 19: 48,722,925 Y643F probably damaging Het
Spink1 G T 18: 43,735,222 S23* probably null Het
Stag1 T C 9: 100,845,116 probably null Het
Tnfaip8l1 G A 17: 56,172,030 V107I probably benign Het
Tnik A G 3: 28,646,681 S907G probably damaging Het
Ttf1 T A 2: 29,067,185 M489K probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp54 G A 14: 20,564,940 A811V probably benign Het
Xirp2 A G 2: 67,514,471 N2352S probably benign Het
Zan T C 5: 137,388,992 Y4933C unknown Het
Zbtb8a A G 4: 129,360,219 S161P probably benign Het
Zkscan5 A T 5: 145,220,940 I751L probably benign Het
Zscan4d A G 7: 11,165,095 F85S probably damaging Het
Zzef1 A G 11: 72,915,265 M2647V probably benign Het
Other mutations in Adgra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Adgra3 APN 5 50025758 missense probably damaging 1.00
IGL00848:Adgra3 APN 5 50001949 missense probably damaging 1.00
IGL01455:Adgra3 APN 5 49987557 nonsense probably null
IGL01665:Adgra3 APN 5 50006930 missense possibly damaging 0.64
IGL02151:Adgra3 APN 5 49979142 missense probably benign
IGL02239:Adgra3 APN 5 49960712 missense probably damaging 1.00
IGL02351:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02358:Adgra3 APN 5 50058558 missense probably benign 0.19
IGL02938:Adgra3 APN 5 49961317 missense probably benign 0.01
IGL03028:Adgra3 APN 5 50016852 missense probably benign 0.30
aperture UTSW 5 49999145 nonsense probably null
saltatory UTSW 5 49960559 missense probably benign 0.09
ANU74:Adgra3 UTSW 5 49961038 missense probably benign 0.16
R0041:Adgra3 UTSW 5 49960559 missense probably benign 0.09
R0121:Adgra3 UTSW 5 50025786 splice site probably benign
R0125:Adgra3 UTSW 5 50001852 splice site probably benign
R0137:Adgra3 UTSW 5 49963840 splice site probably benign
R0415:Adgra3 UTSW 5 49961757 splice site probably benign
R0479:Adgra3 UTSW 5 49990265 missense probably benign 0.00
R0505:Adgra3 UTSW 5 50009334 critical splice donor site probably null
R0831:Adgra3 UTSW 5 49970802 missense probably damaging 1.00
R0883:Adgra3 UTSW 5 49960723 missense probably damaging 1.00
R0920:Adgra3 UTSW 5 49961161 missense probably benign 0.19
R1139:Adgra3 UTSW 5 49961755 splice site probably null
R1211:Adgra3 UTSW 5 50006876 missense possibly damaging 0.88
R1370:Adgra3 UTSW 5 49960787 missense possibly damaging 0.56
R1530:Adgra3 UTSW 5 49961137 missense probably benign 0.00
R1703:Adgra3 UTSW 5 50006775 missense probably benign 0.00
R1782:Adgra3 UTSW 5 49972062 missense probably benign 0.02
R1843:Adgra3 UTSW 5 49961492 missense probably damaging 1.00
R2157:Adgra3 UTSW 5 50001941 missense possibly damaging 0.87
R2281:Adgra3 UTSW 5 50001880 missense probably benign 0.04
R2385:Adgra3 UTSW 5 49979566 missense possibly damaging 0.95
R3084:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3086:Adgra3 UTSW 5 50013391 critical splice donor site probably null
R3409:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3410:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R3411:Adgra3 UTSW 5 50001930 missense probably damaging 1.00
R4301:Adgra3 UTSW 5 49961078 missense possibly damaging 0.94
R4360:Adgra3 UTSW 5 49990210 missense possibly damaging 0.92
R4475:Adgra3 UTSW 5 50001898 missense probably damaging 1.00
R4569:Adgra3 UTSW 5 49960563 missense probably damaging 1.00
R4607:Adgra3 UTSW 5 49970739 missense probably damaging 0.98
R4667:Adgra3 UTSW 5 49978956 missense possibly damaging 0.94
R4671:Adgra3 UTSW 5 49979368 missense probably damaging 1.00
R4886:Adgra3 UTSW 5 49999195 missense probably benign 0.07
R5197:Adgra3 UTSW 5 49960754 missense probably benign 0.01
R5208:Adgra3 UTSW 5 50011515 missense probably damaging 0.99
R5313:Adgra3 UTSW 5 49961309 missense probably benign 0.24
R5435:Adgra3 UTSW 5 49990126 missense probably damaging 0.99
R5663:Adgra3 UTSW 5 49999285 missense probably benign 0.14
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6038:Adgra3 UTSW 5 49999145 nonsense probably null
R6064:Adgra3 UTSW 5 49960325 missense probably damaging 0.97
R6259:Adgra3 UTSW 5 49999141 missense possibly damaging 0.63
R6272:Adgra3 UTSW 5 50009449 missense possibly damaging 0.61
R6293:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6296:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6297:Adgra3 UTSW 5 49960847 missense probably benign 0.21
R6352:Adgra3 UTSW 5 49979136 missense probably benign
R6352:Adgra3 UTSW 5 49990250 missense probably benign 0.01
R6989:Adgra3 UTSW 5 50006884 missense probably damaging 1.00
R7026:Adgra3 UTSW 5 49960741 missense probably benign
R7147:Adgra3 UTSW 5 49961245 missense probably damaging 1.00
R7206:Adgra3 UTSW 5 50006896 missense probably damaging 1.00
R7381:Adgra3 UTSW 5 50058774 start codon destroyed probably null
R7508:Adgra3 UTSW 5 50016867 missense probably benign 0.10
R7538:Adgra3 UTSW 5 49961450 missense probably benign 0.01
R7579:Adgra3 UTSW 5 49987635 missense probably benign
RF036:Adgra3 UTSW 5 50058641 small deletion probably benign
X0065:Adgra3 UTSW 5 49971962 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCAGATTAACTGTGCCGAG -3'
(R):5'- AGGACTAACCAGTTTACGATCCAC -3'

Sequencing Primer
(F):5'- CCAGATTAACTGTGCCGAGATTCTG -3'
(R):5'- CACCTTGTGCTTTACAACAAAAAGG -3'
Posted On2014-11-12